ID: 1108004665

View in Genome Browser
Species Human (GRCh38)
Location 13:45934624-45934646
Sequence CAGTATCAGGAAGAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108004655_1108004665 19 Left 1108004655 13:45934582-45934604 CCTGCACTGCTTGGTTTTATGCC No data
Right 1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG No data
1108004658_1108004665 -2 Left 1108004658 13:45934603-45934625 CCGGAAGGTTTTCCCAACTTCCA No data
Right 1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108004665 Original CRISPR CAGTATCAGGAAGAGGAGGC TGG Intergenic
No off target data available for this crispr