ID: 1108005410

View in Genome Browser
Species Human (GRCh38)
Location 13:45941425-45941447
Sequence CCCCAGCTGCAGAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108005410_1108005418 17 Left 1108005410 13:45941425-45941447 CCAGCCTCCCTCTGCAGCTGGGG No data
Right 1108005418 13:45941465-45941487 ACCAATCAGAGCTGCTACAAAGG No data
1108005410_1108005415 -10 Left 1108005410 13:45941425-45941447 CCAGCCTCCCTCTGCAGCTGGGG No data
Right 1108005415 13:45941438-45941460 GCAGCTGGGGCCATGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108005410 Original CRISPR CCCCAGCTGCAGAGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr