ID: 1108005786

View in Genome Browser
Species Human (GRCh38)
Location 13:45944921-45944943
Sequence TTTCACAAGCAGACTTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108005786_1108005790 16 Left 1108005786 13:45944921-45944943 CCCTCCAAAGTCTGCTTGTGAAA No data
Right 1108005790 13:45944960-45944982 TTAATTTATGCTGCACCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108005786 Original CRISPR TTTCACAAGCAGACTTTGGA GGG (reversed) Intergenic
No off target data available for this crispr