ID: 1108007179

View in Genome Browser
Species Human (GRCh38)
Location 13:45961056-45961078
Sequence CAAATCTGGTGATAGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108007179_1108007181 1 Left 1108007179 13:45961056-45961078 CCTGGGCTCTATCACCAGATTTG 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1108007181 13:45961080-45961102 AGAATGAGAATCACCATAGTTGG 0: 1
1: 0
2: 1
3: 14
4: 169
1108007179_1108007183 18 Left 1108007179 13:45961056-45961078 CCTGGGCTCTATCACCAGATTTG 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1108007183 13:45961097-45961119 AGTTGGACTAGAATACCTTAAGG 0: 1
1: 0
2: 1
3: 5
4: 76
1108007179_1108007184 19 Left 1108007179 13:45961056-45961078 CCTGGGCTCTATCACCAGATTTG 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1108007184 13:45961098-45961120 GTTGGACTAGAATACCTTAAGGG 0: 1
1: 0
2: 2
3: 17
4: 91
1108007179_1108007186 28 Left 1108007179 13:45961056-45961078 CCTGGGCTCTATCACCAGATTTG 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1108007186 13:45961107-45961129 GAATACCTTAAGGGAAAAAAGGG 0: 1
1: 1
2: 6
3: 74
4: 729
1108007179_1108007187 29 Left 1108007179 13:45961056-45961078 CCTGGGCTCTATCACCAGATTTG 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1108007187 13:45961108-45961130 AATACCTTAAGGGAAAAAAGGGG 0: 1
1: 0
2: 2
3: 42
4: 479
1108007179_1108007185 27 Left 1108007179 13:45961056-45961078 CCTGGGCTCTATCACCAGATTTG 0: 1
1: 0
2: 1
3: 16
4: 139
Right 1108007185 13:45961106-45961128 AGAATACCTTAAGGGAAAAAAGG 0: 1
1: 0
2: 3
3: 38
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108007179 Original CRISPR CAAATCTGGTGATAGAGCCC AGG (reversed) Intronic
903457518 1:23497942-23497964 CACAACATGTGATAGAGCCCAGG - Intergenic
903838451 1:26221130-26221152 CAAATCTTGGGATAGAGACCAGG + Intergenic
910496909 1:87840163-87840185 AATATCTGGAGGTAGAGCCCAGG + Intergenic
915491754 1:156253902-156253924 CAAATCTGCAGATTCAGCCCAGG + Intronic
916721283 1:167486295-167486317 CAACTCTGGGGAAAGTGCCCTGG + Intronic
920919361 1:210285640-210285662 CAAGGCTGGTGACAGAGCACTGG - Intergenic
923570886 1:235113565-235113587 CAGATCTAGTGATTGTGCCCTGG - Intronic
1062991141 10:1820184-1820206 CCTCTCTGGTGATAGAGCTCTGG - Intergenic
1063463761 10:6230302-6230324 AAATTCTGGTCACAGAGCCCAGG - Intronic
1067199717 10:44156739-44156761 CAAAACTGTTGAGAGAGTCCTGG + Intergenic
1069600626 10:69704389-69704411 CAAAACAGGTGATAGAGGCTAGG - Intergenic
1070664704 10:78334800-78334822 CAAAGCTGGGGTTTGAGCCCAGG + Intergenic
1070696418 10:78567079-78567101 CAGAGCTGGTGTCAGAGCCCTGG - Intergenic
1072224803 10:93359155-93359177 CAAAGCTGGTGCTGGAACCCGGG - Intronic
1072988205 10:100162836-100162858 AAAAGCTGGTGATAGGGCACTGG + Intronic
1074375934 10:112940709-112940731 CAAAGCTGGGGAGAGAGCTCTGG + Intergenic
1074484930 10:113866752-113866774 CAAACCTGGTGAAGGAGCCGGGG - Intronic
1075196009 10:120359614-120359636 TAAATGTGGAGATACAGCCCTGG - Intergenic
1077580727 11:3415556-3415578 GAATTCTGGTGATGGAGCACAGG + Intergenic
1078049169 11:7946620-7946642 CAAATGGGGTGATGGGGCCCAGG + Intergenic
1080215215 11:29832281-29832303 AAAATGTGGAGTTAGAGCCCCGG + Intergenic
1083261086 11:61523539-61523561 CAGAGCTGGGGATAGAACCCAGG + Intronic
1084237651 11:67798385-67798407 GAATTCTGGTGATGGAGCACAGG + Intergenic
1084694621 11:70746171-70746193 CAGATCTGGGGGCAGAGCCCAGG + Intronic
1085770713 11:79323413-79323435 CATATCTGGTGATAATTCCCTGG + Intronic
1087573233 11:99957799-99957821 AAAATCTTGTGATATAGCTCTGG - Intronic
1088123428 11:106395851-106395873 CAGATCAGGTGATAGAGGCTAGG - Intergenic
1088270654 11:108031041-108031063 CAAATCTGTTGATATTGCTCAGG - Intronic
1095983767 12:47986724-47986746 CAGATTGGGGGATAGAGCCCTGG + Intronic
1096083998 12:48852812-48852834 GAAAACAGGTGCTAGAGCCCAGG - Intronic
1098270070 12:68761545-68761567 GGCATCTGGTGGTAGAGCCCAGG - Intronic
1099963511 12:89419579-89419601 CAGCTCTGGAGATAGGGCCCAGG + Intergenic
1105681364 13:22731134-22731156 CAAATTTGGTGATAGTGTCTTGG - Intergenic
1105844431 13:24282056-24282078 CAATTCTGTAAATAGAGCCCAGG - Intronic
1106880387 13:34122831-34122853 CAAATATGTTGATAGAGGCATGG + Intergenic
1108007179 13:45961056-45961078 CAAATCTGGTGATAGAGCCCAGG - Intronic
1122748857 14:103918286-103918308 CAGAGCTGGTGTTGGAGCCCAGG - Intronic
1122919199 14:104873158-104873180 CAGGTCTGGTGAGAAAGCCCTGG + Intronic
1126704910 15:51397663-51397685 CAAATCTGGTCACAGAGCCTGGG - Intronic
1129139931 15:73588483-73588505 AAAGTCTGGTGATAAATCCCAGG + Intronic
1131626418 15:94125232-94125254 CAAATATGCTGATAGGTCCCTGG - Intergenic
1132677479 16:1126709-1126731 TAAATCTGGTGACAGACCCCAGG + Intergenic
1133533296 16:6675462-6675484 CAAATTTAGTGACAAAGCCCTGG + Intronic
1135103990 16:19631413-19631435 CAATTTTGGTGTTAGAGGCCAGG - Intronic
1140330195 16:74049127-74049149 CAAATCTGGGGCCAGAGTCCAGG - Intergenic
1143597525 17:7924144-7924166 CCAATCTTGTGGTAGAGCTCTGG + Exonic
1145217922 17:21066183-21066205 CAACTCTGGTGCTAGAGCCCCGG - Intergenic
1145414558 17:22704022-22704044 CCAGTCTGGTGCTAGAGCCTGGG - Intergenic
1146535258 17:33645220-33645242 CAAATCTGGAGATGAATCCCTGG + Intronic
1153452185 18:5241782-5241804 AAACTCTGGGGATAGGGCCCAGG - Intergenic
1155213638 18:23623312-23623334 CAAATCTGATTTTGGAGCCCAGG + Intronic
1158574600 18:58625537-58625559 AAACTCTGGGGATGGAGCCCAGG + Intronic
1161883908 19:6978235-6978257 CAAATCTGGTGGTATAACCGTGG - Intergenic
1162393962 19:10405327-10405349 CAGAACTGGGGATAGAGCGCCGG + Intronic
1165063896 19:33218242-33218264 CAAGGCTAGTGATACAGCCCTGG - Intronic
1166255126 19:41598954-41598976 CAAATCTAGAGCTAAAGCCCAGG - Intronic
1166412121 19:42562240-42562262 CACATCTGGGGCTAAAGCCCAGG + Intergenic
1166824243 19:45599339-45599361 CAAGGCTGGTGAGTGAGCCCAGG - Intronic
927797608 2:26064216-26064238 CAAATCCTGTGATAAAGCCAAGG + Intronic
929942116 2:46342119-46342141 AATCTCTGGGGATAGAGCCCAGG + Intronic
931969004 2:67565513-67565535 CAATTCTGCTGATAGAGACCTGG - Intergenic
933632603 2:84674270-84674292 CAAAACTGGGATTAGAGCCCAGG + Intronic
934477394 2:94602608-94602630 CATCTCTGGTGAGTGAGCCCAGG + Exonic
936474283 2:112826104-112826126 CATATCTGTTGATAGAGGCAAGG - Intergenic
941656240 2:168147820-168147842 AAAATCGGGTGAAAGGGCCCTGG - Intronic
945609865 2:211986619-211986641 GAAATCTGGCCCTAGAGCCCAGG - Intronic
948018279 2:234708314-234708336 CAAATCTCGAGATTCAGCCCAGG + Intergenic
1172483815 20:35287038-35287060 CAGACCTGGTGATCGGGCCCTGG - Exonic
1177037312 21:16060283-16060305 CAAATAGGGTGATATAGCCCTGG + Intergenic
1177575255 21:22946410-22946432 CAAAGCTGTTGGAAGAGCCCTGG + Intergenic
1178418702 21:32425893-32425915 CAAATCTGCTGGTCTAGCCCAGG - Intronic
1181733710 22:24865970-24865992 CAAATGTGGTGATAGATCCAGGG + Intronic
949951297 3:9230969-9230991 CAAATCTAGTAACAGAGCCCTGG - Intronic
950198527 3:11026620-11026642 CAGATCTGGAGTTGGAGCCCAGG + Intronic
951775866 3:26309689-26309711 CAAAGCAGGTGATAGAGGCTAGG - Intergenic
955645161 3:61129502-61129524 CCACTCTGGAGATGGAGCCCAGG + Intronic
957053603 3:75428147-75428169 GAATTCTGGTGATGGAGCACAGG + Intergenic
957982861 3:87533391-87533413 CCAGTCTGGTGCCAGAGCCCAGG + Intergenic
960151645 3:114255020-114255042 CAGCTATGGTGATAGAGCACAGG - Intergenic
960386027 3:117023075-117023097 CATAGCCGGTGATAGAGCCAGGG + Intronic
961105316 3:124235695-124235717 CAAAGATGGTGAGAGAGCACCGG - Intronic
961196272 3:125004087-125004109 CACATCTGCAGATAGAACCCCGG - Intronic
961654840 3:128435518-128435540 AAAATCTGGTGACAGAGGCTGGG - Intergenic
966375145 3:179289068-179289090 CAGATCTGCTGATAGAGAGCTGG + Intergenic
967270096 3:187725919-187725941 CAAAGCTGGTTCTAAAGCCCAGG - Intronic
967867061 3:194198879-194198901 CCAATCTGGTGAGAGAGCCAGGG - Intergenic
969291810 4:6244969-6244991 CAGAGCTGGTGATAGAGGCAAGG + Intergenic
969817560 4:9697757-9697779 GAATTCTGGTGATGGAGCACAGG - Intergenic
970062276 4:12048353-12048375 CAAATCTTTTGATAGATCCATGG - Intergenic
970159097 4:13171302-13171324 CAGATGTGGTAGTAGAGCCCCGG + Intergenic
971475464 4:27067974-27067996 CAAATCTGATGATAGCTCTCCGG - Intergenic
971639269 4:29108686-29108708 CAAACCTGGTGAAATAGACCAGG - Intergenic
972706230 4:41546016-41546038 GAAATCTGTTGACAGAGCCTGGG - Intronic
972835075 4:42861018-42861040 CAAATCTGAAGATAGATTCCAGG + Intergenic
977287417 4:95125938-95125960 CAAAGGTGATGCTAGAGCCCAGG - Intronic
977749480 4:100591771-100591793 CAACCGTGGAGATAGAGCCCAGG - Intronic
985139588 4:186825695-186825717 TAAATCTGGTAATACAGCCTAGG - Intergenic
985618481 5:938678-938700 CAAAACAGGAGATTGAGCCCAGG - Intergenic
985673059 5:1216266-1216288 CCACTCTGGTTATAGAGCTCAGG - Intronic
986128720 5:4907828-4907850 AAAATCTGCTGATTGAGGCCTGG + Intergenic
988145512 5:27300832-27300854 TAAAGCTGGTCATACAGCCCAGG + Intergenic
992024019 5:72653126-72653148 CAACTCTGGTGAGAGACTCCTGG - Intergenic
994131091 5:96228454-96228476 CAAATCTGGTGATAGAACAGGGG - Intergenic
996633539 5:125665073-125665095 CATATCTAGTGATGGAACCCAGG - Intergenic
996665050 5:126049600-126049622 CAATTCTAGTGACACAGCCCAGG + Intergenic
996996056 5:129697895-129697917 CCAATTTGGTGAAAGAGCCATGG + Intronic
999136444 5:149323032-149323054 CAAATCTGGTGTTAGGGGCCTGG - Intronic
1000442979 5:161285078-161285100 CAACTCTGGTGATAGAGAATGGG - Intergenic
1007045925 6:38774170-38774192 CAAAACTGAAGATAGAGCTCTGG - Intronic
1015091535 6:129364675-129364697 CAAATTTGGTGGTAGGGGCCAGG - Intronic
1015374346 6:132492629-132492651 CAAAGCTGGTATTTGAGCCCAGG - Intronic
1015795535 6:137007431-137007453 CATGGCTGGTGATAGAGCCAAGG + Intronic
1017846057 6:158259600-158259622 CCAAGCTGGTGTTAGAGCACTGG - Intronic
1018984620 6:168626852-168626874 AAAATGTGGTGATAGAGACCCGG + Intronic
1019947847 7:4344256-4344278 CAACCCTGGTGATACTGCCCCGG - Intergenic
1020320678 7:6936878-6936900 GAATTCTGGTGATAGAGCACAGG + Intergenic
1020745635 7:12075044-12075066 CAAAGCAGGTGATAGAGGCTGGG - Intergenic
1020792116 7:12640490-12640512 CAATTCTGGTGATAGATGCCAGG - Exonic
1022180468 7:27914065-27914087 CAAATCTGGGGACAGAGCACAGG + Intronic
1022410816 7:30136878-30136900 CAAATTTGGGGTTAGAGACCTGG + Intronic
1025966395 7:66276703-66276725 GAAATAAGGTGATAGAGCTCAGG - Intronic
1030008900 7:105146076-105146098 CAAATCTGTTGATACAACTCAGG + Intronic
1033163165 7:139015260-139015282 CAAAGCTGGTGACAGAGCAGGGG + Intergenic
1033471497 7:141653584-141653606 CAAATTTGGGGATGGGGCCCAGG + Exonic
1035725051 8:1819060-1819082 CCTATTTGATGATAGAGCCCAGG + Intergenic
1042089827 8:65146527-65146549 TAATTTTGGAGATAGAGCCCTGG - Intergenic
1044303440 8:90610919-90610941 CTAATCTGGGAATTGAGCCCAGG - Intergenic
1046602765 8:116336987-116337009 CAAATCTTATAATAGAGCCAAGG + Intergenic
1047315300 8:123727569-123727591 AATATCTAGTGATAGAGGCCAGG + Intronic
1048291330 8:133183789-133183811 GAAATCTGGACACAGAGCCCTGG + Intergenic
1050142567 9:2531665-2531687 TAAGTCTGGTGATAGGTCCCAGG - Intergenic
1052852578 9:33386954-33386976 CATCTCTGGTGAGTGAGCCCAGG - Exonic
1053680679 9:40483505-40483527 CACCTCTGGTGAGTGAGCCCAGG - Intergenic
1053930664 9:43111817-43111839 CATCTCTGGTGAGTGAGCCCAGG - Intergenic
1054283034 9:63141430-63141452 CACCTCTGGTGAGTGAGCCCAGG + Intergenic
1054293761 9:63319020-63319042 CACCTCTGGTGAGTGAGCCCAGG - Intergenic
1054391785 9:64623509-64623531 CACCTCTGGTGAGTGAGCCCAGG - Intergenic
1054503942 9:65892819-65892841 CACCTCTGGTGAGTGAGCCCAGG + Intronic
1055958711 9:81798963-81798985 CAAATCTGGTGGTGGAGATCTGG + Intergenic
1056598746 9:88029445-88029467 CAAATCTGAAGGTTGAGCCCTGG - Intergenic
1058543288 9:106034534-106034556 CAAAGCTGGGAATGGAGCCCAGG - Intergenic
1061741697 9:132711287-132711309 AATCTCTGGGGATAGAGCCCAGG + Intergenic
1061980427 9:134100126-134100148 CAACTCTGGGGACAGAGCACGGG - Intergenic
1186139775 X:6559355-6559377 CAAATCTGGAGAAACAGCCCTGG + Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1189250705 X:39598985-39599007 CCACTCTGGGGATGGAGCCCAGG - Intergenic
1189660669 X:43294600-43294622 CAAATCTGGTAATAGACTCCAGG - Intergenic
1190659086 X:52638353-52638375 CAAAAGTGGTCATAGAGGCCAGG + Intergenic
1192299835 X:69888820-69888842 TAAATCTGTTGATGGACCCCTGG + Intronic
1193853286 X:86566898-86566920 CAAAGCTGGAATTAGAGCCCAGG + Intronic
1195065299 X:101234064-101234086 CACATCTGGGGACAGAGCCATGG - Intronic
1199535763 X:148901175-148901197 CAAATCTGGGACTAGAACCCAGG + Intronic
1200038595 X:153349343-153349365 CAGAACTGGGGATAGACCCCAGG + Exonic
1200987301 Y:9316264-9316286 CAAAACTGATGTTAAAGCCCGGG - Intergenic
1201725984 Y:17152636-17152658 CAATTCTGCTCATGGAGCCCGGG + Intergenic
1202184720 Y:22174382-22174404 CAAAACTGATGTTAAAGCCCGGG - Intronic
1202206640 Y:22412019-22412041 CAAAACTGATGTTAAAGCCCGGG + Intronic