ID: 1108009808

View in Genome Browser
Species Human (GRCh38)
Location 13:45994362-45994384
Sequence CCTACCCCTTCATTGTTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 3, 2: 18, 3: 110, 4: 436}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108009808 Original CRISPR CCTACCCCTTCATTGTTCAA GGG Intronic
902108004 1:14053727-14053749 CTAATCCCTGCATTGTTCAAGGG - Intergenic
902571720 1:17351523-17351545 CCTCACCCTTCAGGGTTCAAGGG - Intronic
903026869 1:20435607-20435629 CCAACCCCATCAGTGTTCAGGGG + Intergenic
903143605 1:21355578-21355600 CCAACCCCTTCATTTTACAAAGG - Intergenic
903355509 1:22744275-22744297 CCTACCCCCACATTGTTCAAGGG - Intronic
903617772 1:24674673-24674695 TCAACCCTCTCATTGTTCAAGGG - Intergenic
903760283 1:25692974-25692996 CTTACCCCTGTGTTGTTCAAGGG - Intronic
904208546 1:28870941-28870963 CCTACCCCTCCATCGTGCAGAGG - Intergenic
904315615 1:29658598-29658620 CTTATCCATTCATTCTTCAATGG + Intergenic
905099317 1:35504681-35504703 CTAACCCCTACACTGTTCAAGGG + Intronic
905847950 1:41249038-41249060 CTAACCCCCACATTGTTCAAGGG - Intergenic
906398049 1:45484052-45484074 CCAACCCCTGTTTTGTTCAAGGG + Intronic
906693341 1:47807427-47807449 CCCAAGCCTTCATTGTTGAATGG - Intronic
909520844 1:76565824-76565846 CTCACCCCTACATTGTTCCAGGG - Intronic
909835307 1:80247278-80247300 CTAATCCCTGCATTGTTCAAGGG - Intergenic
909885261 1:80934097-80934119 CCTAACCCTTTATGGTTCAAGGG - Intergenic
910052895 1:82996988-82997010 CTTAACCCTGTATTGTTCAAGGG + Intergenic
910173507 1:84403181-84403203 CCTACCCCAGCATGGTTCAAGGG - Intronic
910203296 1:84722457-84722479 TCTACCCCTTGACTGTTCAAAGG + Intergenic
911456746 1:98134096-98134118 CCAACCCCTGCATTGTTCAAGGG - Intergenic
912664814 1:111569456-111569478 CTAACCCCTTCATTATTCAGGGG + Intronic
912780139 1:112538740-112538762 CCTACCCCCTTCTTGTTTAAAGG - Intronic
912839038 1:113022710-113022732 CCTCCACCTTCTTGGTTCAAGGG + Intergenic
913647270 1:120870286-120870308 CCTAACCCTATGTTGTTCAAGGG + Intergenic
914079373 1:144392573-144392595 CCTAACCCTATATTGTTCAAGGG - Intergenic
914099806 1:144573929-144573951 CCTAACCCTATATTGTTCAAGGG + Intergenic
914174274 1:145261119-145261141 CCTAACCCTATGTTGTTCAAGGG - Intergenic
914299181 1:146363752-146363774 CCTAACCCTATGTTGTTCAAGGG - Intergenic
914422653 1:147543187-147543209 CCTACACATTGATTGTTTAAAGG + Intronic
914528938 1:148502303-148502325 CCTAACCCTATGTTGTTCAAGGG - Intergenic
914637454 1:149564805-149564827 CCTAACCCTATGTTGTTCAAGGG + Intergenic
914725379 1:150322956-150322978 CCTCCGCCTTCCATGTTCAAGGG + Intronic
915474894 1:156147540-156147562 CCACCCCCTGCATTGTTCACTGG - Intronic
915824796 1:159064169-159064191 CTAATCCCTACATTGTTCAAGGG + Intronic
915997686 1:160580812-160580834 CAAACCCCTGCATTGTTCAAGGG - Intergenic
916385602 1:164264008-164264030 CCAACCCCTACGTTGTTTAAGGG - Intergenic
916504135 1:165412487-165412509 TCTACCCCTTCCTTGCTAAATGG + Intronic
916937713 1:169646765-169646787 CCTCCTTCTTCATTGTTCAAAGG - Intergenic
917390809 1:174534103-174534125 CCAACTCCTGCATTGTTCAGAGG + Intronic
917949371 1:180014797-180014819 CCAACCCCCACATCGTTCAAAGG - Intronic
919154270 1:193741877-193741899 CCGGCCCTTTCATTGTTCAAGGG + Intergenic
919331270 1:196175249-196175271 CCTAACCCTGAATTGTTCAAGGG + Intergenic
920008271 1:202849435-202849457 CCAACCCCTGTGTTGTTCAAGGG + Intergenic
920533409 1:206721780-206721802 CCAACCTTTGCATTGTTCAAGGG - Intronic
921003734 1:211070892-211070914 CTAACTCCTGCATTGTTCAAGGG - Intronic
921080345 1:211733967-211733989 CTAACTCCCTCATTGTTCAAGGG - Intergenic
921299749 1:213739440-213739462 CTAACCCCTACGTTGTTCAAGGG + Intergenic
921443825 1:215220996-215221018 CTCACTCCTGCATTGTTCAAGGG - Intronic
921543908 1:216451695-216451717 CCAACCCCTACTTTGTTCAGGGG - Intergenic
922949460 1:229546443-229546465 CCAACCCCTGCATTGTTCAAGGG + Intronic
923054059 1:230412209-230412231 TTAACCCCTGCATTGTTCAAGGG - Intronic
923560252 1:235034568-235034590 CCTCCACCTTCCTGGTTCAAGGG + Intergenic
923615648 1:235534884-235534906 CTAATCCCTGCATTGTTCAAGGG + Intergenic
924143600 1:241050996-241051018 CTAACCCCCACATTGTTCAAAGG + Intronic
1063260197 10:4379158-4379180 CCTGTCCCCACATTGTTCAAGGG + Intergenic
1063821702 10:9843659-9843681 CTAATCCCTGCATTGTTCAAGGG + Intergenic
1064741252 10:18437325-18437347 CATAACCTCTCATTGTTCAATGG - Intronic
1065648067 10:27857448-27857470 CTAACTCCTGCATTGTTCAAAGG + Intronic
1065990026 10:30999971-30999993 CCTATTCCTTCATCATTCAAAGG - Intronic
1066237049 10:33495632-33495654 CCAACCCATGCATTGTTCAAGGG - Intergenic
1067063779 10:43092092-43092114 CTTATCCATTCATTGGTCAATGG - Intronic
1069014439 10:63412104-63412126 CCAACCCCTGAATTGTTCCAGGG - Intronic
1069096399 10:64264825-64264847 CCAACCCCTGCATTGTTGAAGGG - Intergenic
1069204794 10:65668099-65668121 CCTACCACATCATATTTCAAGGG - Intergenic
1069316571 10:67111495-67111517 CCAAGACCTTCATTATTCAAGGG - Intronic
1070079710 10:73173572-73173594 CTAACCCCTGCATTGTTTAAGGG - Intronic
1071016787 10:81006856-81006878 TTCACCCCTACATTGTTCAAAGG + Intergenic
1072326018 10:94299571-94299593 CCTGCCGCTTGACTGTTCAAAGG - Intronic
1072687146 10:97544482-97544504 CCTAACCCTGCGTTGTTCAAGGG - Intronic
1073078986 10:100845226-100845248 CCAGCCCCTGCAGTGTTCAATGG + Intergenic
1073248809 10:102109282-102109304 CCCACCCCTTCCTTGTTCCCGGG - Intronic
1073574289 10:104608745-104608767 CCTACCCCTTCCCCATTCAACGG + Intergenic
1073613663 10:104970548-104970570 CCTACCCCTTCATAGTGCCATGG + Intronic
1073965395 10:108983182-108983204 CTAACTCCTCCATTGTTCAAGGG - Intergenic
1074107163 10:110397110-110397132 CTAATCCCCTCATTGTTCAAGGG - Intergenic
1074195981 10:111185687-111185709 CTATCCCCTACATTGTTCAAGGG + Intergenic
1074428659 10:113374210-113374232 ACCACCCCTTCATTTTACAAAGG + Intergenic
1074910197 10:117901445-117901467 CCTAACCCTGTGTTGTTCAAGGG - Intergenic
1075133971 10:119765714-119765736 CTAACTCCTGCATTGTTCAAGGG + Intronic
1077486321 11:2839998-2840020 CCCAACCCTGCATTGTTCAAGGG - Intronic
1077544452 11:3163206-3163228 CATTCCCATTTATTGTTCAAGGG - Intronic
1080121710 11:28685434-28685456 CCAACCTCTGCATTGTTCAAGGG - Intergenic
1080591837 11:33731202-33731224 CCTAACCCTGCATTGTTTTAGGG + Intronic
1081190688 11:40100107-40100129 CCTTCCCCTTCCCTGTCCAAGGG + Intergenic
1081279743 11:41194313-41194335 CTAACCCCTATATTGTTCAAGGG + Intronic
1081467108 11:43331191-43331213 CTAAGCCCTTCATTGTTCAAGGG - Intronic
1082053151 11:47789776-47789798 CTAAACCCTGCATTGTTCAAGGG - Intronic
1082100014 11:48164865-48164887 CCTTCCCCTCCATTTTTAAAAGG + Intronic
1083134098 11:60655316-60655338 GCCACCCCATCATTGTCCAATGG + Intergenic
1084755030 11:71232859-71232881 CCAACCTCTCCATTGTTCAAAGG + Intronic
1085027745 11:73247018-73247040 CTAACCCCTGCACTGTTCAAGGG + Intergenic
1085073976 11:73573374-73573396 CCTCCCACTTCCTTGTTCTAGGG + Intronic
1086186544 11:84024114-84024136 CCCAACCCTACATTGTTTAAGGG + Intronic
1086273188 11:85093097-85093119 CTCGCCCCCTCATTGTTCAAGGG + Intronic
1086404729 11:86489813-86489835 CCTCCCCCTTTATTCTTCACAGG + Intronic
1086617481 11:88839693-88839715 CTAACTCCTGCATTGTTCAAGGG - Intronic
1087079327 11:94154667-94154689 CCGACCCCCACATTGTTCAAGGG - Intronic
1087177464 11:95108741-95108763 CCTCCCCCTCCATTGTTGAAAGG + Intronic
1087245181 11:95826653-95826675 CTAACCCCTCCATTGTTCAAGGG + Intronic
1087466398 11:98512092-98512114 CTTATCCATTCATTTTTCAATGG + Intergenic
1088235977 11:107723337-107723359 CTCACCCCCTTATTGTTCAAGGG - Intergenic
1088422826 11:109667942-109667964 CCTATTGCTTCCTTGTTCAAGGG - Intergenic
1088543993 11:110941614-110941636 CTAACCCCCACATTGTTCAAGGG - Intergenic
1088664057 11:112076448-112076470 CTAGCCCCTGCATTGTTCAAGGG - Intronic
1089175534 11:116546411-116546433 CCAACCCCTGCATTATTCAAGGG + Intergenic
1089657073 11:119956398-119956420 CTAACACCTGCATTGTTCAAGGG - Intergenic
1089661137 11:119986147-119986169 TTAACCCCTGCATTGTTCAAGGG - Intergenic
1092311874 12:7366013-7366035 CTTACCCATTCATTCATCAAGGG - Intronic
1092788155 12:12048525-12048547 CCTAACCCCACATTGTTCAAGGG - Intergenic
1092981843 12:13803304-13803326 CTAACCCCCACATTGTTCAAGGG + Intronic
1093204329 12:16228951-16228973 CCAACCCCTGCGTTGTTCAAGGG + Intronic
1093327332 12:17793989-17794011 CTAACCCCTACACTGTTCAAGGG - Intergenic
1093896679 12:24582707-24582729 CTAACCCCCACATTGTTCAAAGG - Intergenic
1094122554 12:26989495-26989517 ACAACCCCTACACTGTTCAAAGG + Intronic
1095610861 12:44126277-44126299 CTAACCCCTCCATTGTTCAAAGG + Intronic
1095716940 12:45356357-45356379 CCTACCCCTGTGTTGTTCAAGGG - Intronic
1096041014 12:48517384-48517406 CTAACCCCTTTGTTGTTCAATGG + Intronic
1096569236 12:52511234-52511256 CTTACCCCCTTTTTGTTCAATGG + Intergenic
1097982626 12:65750278-65750300 CCTTCCCCTCCCTAGTTCAAGGG + Intergenic
1097993795 12:65865319-65865341 CCAACCCCTGCATTGTTGAAGGG + Intronic
1098532815 12:71560112-71560134 CCTAACCCCTAGTTGTTCAAGGG - Intronic
1098542294 12:71670447-71670469 CTAAACCCTGCATTGTTCAAGGG - Intronic
1098702019 12:73640550-73640572 CTAACCACTGCATTGTTCAAAGG + Intergenic
1098920557 12:76298405-76298427 CTAACCCCTGCCTTGTTCAAGGG - Intergenic
1098986093 12:77014042-77014064 CCCACCCCTTCATTGTTTAAGGG + Intergenic
1099211842 12:79800599-79800621 CTAACCCTTGCATTGTTCAAGGG + Intronic
1099745569 12:86699549-86699571 CCTACCCCCATGTTGTTCAAGGG - Intronic
1101020166 12:100545849-100545871 CCTCCCCCTTTATTCTTCAGAGG - Intronic
1102441795 12:112969351-112969373 CTTACCCCTTCCTTATTCAGGGG - Intronic
1103551295 12:121739422-121739444 CCTAACCCCACCTTGTTCAAGGG - Intronic
1104253488 12:127119194-127119216 CTGACCCCTACATTGGTCAAGGG + Intergenic
1105398597 13:20066248-20066270 CCAACCACTGCATTGTACAACGG - Intronic
1106373511 13:29160825-29160847 CCCGCCCCTGCATAGTTCAAGGG + Intronic
1106522327 13:30508746-30508768 CCCTCCCCTTCATTTTTCAAGGG + Intronic
1106736537 13:32593245-32593267 CTAACCCCTTCGCTGTTCAAGGG - Intronic
1107374716 13:39789776-39789798 CCTTCCCCTTCCTTGTCCAGGGG + Intronic
1108009808 13:45994362-45994384 CCTACCCCTTCATTGTTCAAGGG + Intronic
1108564805 13:51685333-51685355 CTAACCCCCACATTGTTCAAAGG - Intronic
1108584089 13:51852907-51852929 CCTAAGCACTCATTGTTCAAGGG - Intergenic
1109200029 13:59420027-59420049 CCTAACCTCACATTGTTCAAGGG - Intergenic
1109222702 13:59656385-59656407 CTAACCCCTGCATTGTTCAAAGG + Intergenic
1109927524 13:69164611-69164633 TTTACCCTTGCATTGTTCAAAGG + Intergenic
1110815537 13:79856673-79856695 CCAACCCTGTCATTGATCAATGG + Intergenic
1110953539 13:81523765-81523787 CCAATGCCTGCATTGTTCAAGGG + Intergenic
1111270748 13:85880934-85880956 CCAACTCCTGCATTGTTCAAAGG - Intergenic
1111599376 13:90452139-90452161 CCTAACTCTGCTTTGTTCAAAGG + Intergenic
1111633120 13:90868592-90868614 CCAATCCCTGCATTGTTCAATGG - Intergenic
1112301926 13:98238902-98238924 CCAACCCCCACATTGTTCAAGGG + Intronic
1113281160 13:108789404-108789426 CCTCCCCCTTCATTTTTCAGAGG + Intronic
1115135615 14:30104058-30104080 CTCACCACTACATTGTTCAAGGG + Intronic
1117263554 14:54062069-54062091 CCCAACCCTGCATTGTTGAAGGG + Intergenic
1117950081 14:61074167-61074189 CTGACCCCCACATTGTTCAAAGG + Intronic
1119019335 14:71094067-71094089 CCAACCCCTGCATTATTCCAGGG + Intronic
1119092434 14:71797172-71797194 CCAACCCCTGTGTTGTTCAAGGG + Intergenic
1119585315 14:75828621-75828643 CCAACCCCTGTATTGTTCAAGGG + Intronic
1119608898 14:76045067-76045089 CCAACACCCACATTGTTCAAGGG + Intronic
1119633275 14:76252823-76252845 CCTACCTCTTCCTTGATCATAGG + Intronic
1119646857 14:76354448-76354470 CCTCCCCCTTCAGAGTGCAATGG - Intronic
1120581903 14:86262389-86262411 CTAACCCCTGCGTTGTTCAAGGG + Intergenic
1121150910 14:91633996-91634018 CTAACCTCTGCATTGTTCAAGGG - Intronic
1121804241 14:96801558-96801580 CCAACCCCTGAGTTGTTCAAGGG - Intronic
1122164413 14:99811098-99811120 CTAACCCCTGCGTTGTTCAAGGG - Intronic
1202938440 14_KI270725v1_random:116670-116692 CCTGCCACAACATTGTTCAAAGG - Intergenic
1124577022 15:30918873-30918895 CCAACCCCTGCATCATTCAAGGG - Intronic
1124833016 15:33167551-33167573 CCAACCCCTGCTTTGGTCAAAGG - Intronic
1124870742 15:33539588-33539610 CTAACCCCTACATTGTTTAAGGG - Intronic
1125978814 15:43980853-43980875 CTAACTCCTGCATTGTTCAAGGG - Intronic
1126330794 15:47528804-47528826 CTTACCCCTGAATTGATCAAAGG - Intronic
1127232080 15:57007588-57007610 ACTACCTCTTCATTTTACAAAGG - Intronic
1127434156 15:58939897-58939919 CCTAACCCTGAGTTGTTCAAGGG - Intronic
1129028032 15:72597600-72597622 CCTCCCCTTTCATTTTTAAAGGG + Exonic
1129626005 15:77200420-77200442 CCAACCTCTACATTGTTCAAGGG + Intronic
1131756808 15:95573177-95573199 CCTAACCTTTTGTTGTTCAAGGG - Intergenic
1131911156 15:97204158-97204180 TCAAACCCTGCATTGTTCAAAGG - Intergenic
1132258022 15:100394893-100394915 CTAACCCCTGCATTGTTCATGGG + Intergenic
1132361018 15:101215352-101215374 CCTACCCCTTCATCTTTTTATGG - Intronic
1132773330 16:1577528-1577550 CCTACCCCTGCATTGTTCAAGGG + Intronic
1133872873 16:9705812-9705834 GCTGCCCCTTCATGGTTCCAAGG - Intergenic
1134426330 16:14150343-14150365 CCAACCCCTACATTGTCCAAGGG - Intronic
1135791980 16:25405291-25405313 CTAACCCCTGCATTGTTCGAGGG - Intergenic
1136223239 16:28842349-28842371 CTAACCCCTGCATTGTTCAAGGG + Intergenic
1136241799 16:28949219-28949241 CCTCCACCTTCAGGGTTCAAAGG - Intergenic
1136382608 16:29902814-29902836 CCTACACCTTCTTTTTTAAAAGG + Intronic
1136700858 16:32139637-32139659 CCTGCCACAACATTGTTCAAAGG + Intergenic
1136766797 16:32787822-32787844 CCTGCCACAACATTGTTCAAAGG - Intergenic
1136770506 16:32835518-32835540 CCTGCCACAACATTGTTCAAAGG - Intergenic
1136801298 16:33082556-33082578 CCTGCCACAACATTGTTCAAAGG + Intergenic
1136900100 16:34026475-34026497 CCTGCCACAACATTGTTCAAAGG + Intergenic
1136945113 16:34640536-34640558 CCTGCCACAACATTGTTCAAAGG + Intergenic
1136959168 16:34826068-34826090 CCTGCCACAACATTGTTCAAAGG + Intergenic
1136967288 16:34929375-34929397 CCTGCCACAACATTGTTCAAAGG + Intergenic
1137087908 16:36151487-36151509 CCTGCCACAACATTGTTCAAAGG + Intergenic
1137221482 16:46455959-46455981 CCTGCCACAACATTGTTCAAAGG - Intergenic
1137654176 16:50146106-50146128 CCCAACCCTGAATTGTTCAAGGG + Intergenic
1138070677 16:53990153-53990175 CCAATCCCTACACTGTTCAAAGG + Intronic
1138757905 16:59511407-59511429 CTAACCCCTACATTATTCAAGGG - Intergenic
1138948761 16:61884883-61884905 CTAACCCCTGCATTGTTCAAGGG + Intronic
1139321696 16:66119599-66119621 CCAACCCCATTGTTGTTCAAGGG + Intergenic
1140856479 16:78982122-78982144 CCTTCTCCTTCATTGCTCAGAGG + Intronic
1141069533 16:80940815-80940837 CCTTCCCCTTCAGTGTAGAATGG - Intergenic
1142312487 16:89322162-89322184 CCAACCCCTGTATTGTTCAAGGG + Intronic
1203069192 16_KI270728v1_random:1050074-1050096 CCTGCCACAACATTGTTCAAAGG - Intergenic
1203072926 16_KI270728v1_random:1097622-1097644 CCTGCCACAACATTGTTCAAAGG - Intergenic
1143150585 17:4805588-4805610 CCTCCCCCTTCCAGGTTCAAGGG - Intergenic
1144277504 17:13688155-13688177 CTAACCCCTGCATTGTTCAAGGG + Intergenic
1144481255 17:15630986-15631008 CCAACCCCTACATTGTTCAAGGG + Intronic
1144554158 17:16267021-16267043 CTAACCCTCTCATTGTTCAAAGG - Intronic
1144773999 17:17775141-17775163 CTAACCCCCACATTGTTCAAGGG - Intronic
1144917058 17:18732745-18732767 CCAACCCCTACATTGTTCAAGGG - Intronic
1145095373 17:20020859-20020881 CTGACCCCCTCATTGTTCACGGG - Intronic
1145691366 17:26743631-26743653 CCTGCCACAACATTGTTCAAAGG + Intergenic
1146097976 17:29950882-29950904 CTAACTCCTACATTGTTCAAGGG + Intronic
1146893096 17:36520886-36520908 CTAACCTCTGCATTGTTCAATGG + Intronic
1147369136 17:39979844-39979866 CCTACCCACTTATTTTTCAAAGG - Intergenic
1148084636 17:44986688-44986710 CCTACCTCTTGATTGTTGGAAGG - Intergenic
1148591820 17:48822091-48822113 CTAACCCCTGCATGGTTCAAGGG - Intergenic
1148904551 17:50903894-50903916 CCTACCCATACATTGTAAAATGG + Intergenic
1149599293 17:57882993-57883015 CTAACCCCTGCATTGTTCAATGG + Intronic
1151238588 17:72739811-72739833 CTAATCCCTGCATTGTTCAAGGG - Intronic
1151459499 17:74246096-74246118 CCTTCCCCTTCCTTCTTCCAGGG - Intronic
1153731158 18:8013264-8013286 CCAGCCCCTACACTGTTCAAGGG - Intronic
1154299304 18:13179108-13179130 CTACCCCCTACATTGTTCAAGGG + Intergenic
1154332945 18:13444571-13444593 CCAACCCCCAAATTGTTCAAAGG + Intronic
1154520775 18:15227323-15227345 CCTGCCACAACATTGTTCAAAGG - Intergenic
1155076806 18:22364610-22364632 CCAACCCCCACATTATTCAAGGG + Intergenic
1155106612 18:22673148-22673170 CCTAGCCCCCCATTGTTCAAGGG + Intergenic
1155312131 18:24534394-24534416 CCTACCCCTGAATAGTGCAAAGG + Intergenic
1155394691 18:25375095-25375117 CATACACATTAATTGTTCAATGG + Intergenic
1156038351 18:32791897-32791919 CTGACCCCTACTTTGTTCAAGGG - Intergenic
1156695292 18:39759067-39759089 CTAATCCCTGCATTGTTCAAGGG - Intergenic
1156949549 18:42878139-42878161 CCAACCCTTGCATTGGTCAAGGG - Intronic
1157195603 18:45617938-45617960 CCTAAGCCTTCATTTTTCTAGGG - Intronic
1157462371 18:47910902-47910924 CCAACCACCCCATTGTTCAAGGG + Intronic
1158301247 18:56055656-56055678 CTAACTCCTGCATTGTTCAAGGG - Intergenic
1159139756 18:64379340-64379362 TCTAACCCTGCATTGTTCAAGGG - Intergenic
1159421743 18:68230133-68230155 CTTTCCCCTTCATTGTTTAAGGG + Intergenic
1159753160 18:72328080-72328102 CTAACCCCTACATTGTTAAAGGG - Intergenic
1160031774 18:75268184-75268206 CCTTCCTCTTCATTTTCCAATGG + Intronic
1160148481 18:76382950-76382972 CCTCCCCCTCCAGGGTTCAAGGG - Intronic
1160164258 18:76495946-76495968 ACAACCCCTTCATTTTTAAATGG - Intronic
1160425980 18:78779640-78779662 CCAACCCCTATGTTGTTCAATGG + Intergenic
1161706365 19:5823986-5824008 CCAACCCCTTCCTTGTTCAATGG + Exonic
1162244346 19:9386975-9386997 CCTACTTCTTCATAGTTCACTGG - Intergenic
1162611637 19:11759683-11759705 CTAATCCCTGCATTGTTCAAGGG + Intergenic
1164948290 19:32314586-32314608 CCTGCCTCTTCATTGTGCCAGGG - Intergenic
1166581702 19:43906252-43906274 CCTCCGCCTTCCGTGTTCAAGGG + Intergenic
1167401083 19:49270006-49270028 CCTAACCCTACATCATTCAAGGG + Intergenic
1168027696 19:53655074-53655096 CCTTCACCTTCATTGTGCCATGG + Intergenic
1168451871 19:56472855-56472877 CTAACCCCTGCACTGTTCAAGGG + Intronic
1202671014 1_KI270709v1_random:51710-51732 CCTGCCACAACATTGTTCAAAGG + Intergenic
928018308 2:27680025-27680047 CCCAACCCTTCATTGGTCATAGG + Intronic
928991174 2:37234171-37234193 CCTCCACCTTCAAGGTTCAAAGG + Intronic
929675900 2:43928822-43928844 CTAACCCCTGTATTGTTCAAGGG - Intronic
929845664 2:45522965-45522987 CCAACCTCCACATTGTTCAAGGG + Intronic
930266696 2:49208649-49208671 CTAACCCCTGCGTTGTTCAAGGG + Intergenic
930345160 2:50170813-50170835 CCAACCCCCACATTGTTCAAGGG - Intronic
932383850 2:71312372-71312394 CCAACCCCTATGTTGTTCAAGGG - Intronic
933321373 2:80779547-80779569 CTAACCCCTGCATTGTTCAAGGG - Intergenic
933693814 2:85200270-85200292 CTAACCCCTGCATAGTTCAAAGG - Intronic
934250410 2:90348542-90348564 CCTGCCACAACATTGTTCAAAGG - Intergenic
934259155 2:91454874-91454896 CCTGCCACAACATTGTTCAAAGG + Intergenic
934330797 2:92066001-92066023 CCTGCCACAACATTGTTCAAAGG - Intergenic
934773018 2:96919990-96920012 CCTTCCCCTGCACTGTTCCAAGG - Intronic
934922122 2:98352910-98352932 CCAATCCCTGCATTGCTCAAGGG - Intronic
934996008 2:98961178-98961200 CTAACACCTGCATTGTTCAAGGG + Intergenic
935555996 2:104510083-104510105 CTAACCTTTTCATTGTTCAAAGG - Intergenic
936066777 2:109338496-109338518 CTAACTCCTGCATTGTTCAAGGG - Intronic
936393729 2:112101439-112101461 CCTAACCCTACATTGTTCAAGGG - Intronic
936716058 2:115189166-115189188 CCTTCCCCTCCCTTGTTCAGGGG - Intronic
936960883 2:118073415-118073437 CTTAACCCTGCATTGTGCAATGG + Intergenic
937162392 2:119776927-119776949 CTAAACCCTGCATTGTTCAAAGG + Intronic
937373305 2:121317639-121317661 CCAACCCCTGCACTGCTCAAGGG - Intergenic
937474155 2:122199845-122199867 CTAACCCATGCATTGTTCAAGGG - Intergenic
937708111 2:124944883-124944905 CCTACCTAGTCATTTTTCAAGGG - Intergenic
938045250 2:128113085-128113107 CCCAAACCTTTATTGTTCAAAGG + Exonic
938520127 2:132061093-132061115 CCTGCCACAACATTGTTCAAAGG - Intergenic
939283181 2:140091400-140091422 CTAACCCCTGCATTGTTCAAGGG + Intergenic
939713584 2:145555302-145555324 CTAACCCCTGCATTCTTCAAGGG + Intergenic
939878189 2:147600960-147600982 CCTATCGCCTCATTTTTCAAAGG - Intergenic
940315797 2:152326384-152326406 CCAAACCCTGAATTGTTCAAGGG + Intergenic
940952462 2:159691257-159691279 GCTGCCCCCACATTGTTCAAGGG - Intergenic
941113240 2:161441187-161441209 CCCATCCATTCATTGGTCAAAGG - Intronic
941937763 2:170999698-170999720 CCAACCCCTATATTGTTCAAGGG - Intronic
942158498 2:173156997-173157019 CTAACCCCTGCATTGTTCAAGGG - Intronic
942350707 2:175050094-175050116 CCAATGCCTACATTGTTCAAGGG - Intergenic
942740293 2:179168475-179168497 CTAACCCCTGCATTGTTCACAGG + Intronic
942909559 2:181226757-181226779 CTTACCCCAGCATTGTTCAAGGG + Intergenic
942991162 2:182204787-182204809 CCAACCCCTGTATTGTTCAAGGG + Intronic
943291336 2:186075835-186075857 CTAACCCCTACATTGTTCAAGGG + Intergenic
943687174 2:190830786-190830808 TCTATCCATTCATTCTTCAAGGG + Intergenic
943693851 2:190901125-190901147 CTAACCCCTGCTTTGTTCAAGGG - Intronic
946705421 2:222453843-222453865 CTAACCCGTGCATTGTTCAAGGG + Intronic
946857697 2:223969198-223969220 CTAATCCCTGCATTGTTCAAGGG + Intergenic
948250009 2:236519719-236519741 TTAACCCCTGCATTGTTCAAGGG - Intergenic
948422191 2:237866553-237866575 CCCACCCCTGCGTTGTTCAAGGG - Intronic
1168733618 20:110217-110239 CCTAACCCTGCATATTTCAAAGG - Intergenic
1169615752 20:7443180-7443202 CTAACTCCTGCATTGTTCAAGGG + Intergenic
1169784195 20:9341257-9341279 CTAACCCCCACATTGTTCAAGGG - Intronic
1170580884 20:17698702-17698724 CTTACAACTTCATTGTACAAAGG - Intronic
1171879753 20:30610017-30610039 TCTACCCCTCCATTTTTCCAAGG - Intergenic
1172353867 20:34265568-34265590 CTAACCCCTGCATTGTTCAAGGG + Intronic
1172858469 20:38027414-38027436 CTAACCCCCACATTGTTCAAGGG - Intronic
1173538954 20:43837307-43837329 CCAACCCCCGCATTGTTCAAGGG - Intergenic
1174012784 20:47463986-47464008 CCTCCGCCTCCCTTGTTCAAGGG - Intergenic
1174733813 20:52944765-52944787 CTAACCTCTGCATTGTTCAAGGG - Intergenic
1174768812 20:53278837-53278859 CTAACTCCCTCATTGTTCAAGGG - Intronic
1175569056 20:60005329-60005351 CTAACCCCCACATTGTTCAAGGG + Intronic
1176584875 21:8572466-8572488 CCTGCCACAACATTGTTCAAAGG + Intergenic
1177297471 21:19195288-19195310 GCATCCCCTGCATTGTTCAAGGG + Intergenic
1177635708 21:23784341-23784363 CCCACCCCCATATTGTTCAAGGG + Intergenic
1178208655 21:30501404-30501426 CTAACCCCTACATTATTCAAGGG + Intergenic
1178614385 21:34118171-34118193 CATACCCCTACACTGTTCAAGGG - Intronic
1179206781 21:39288540-39288562 CTAACCCCTGCGTTGTTCAAGGG - Intronic
1180267684 22:10549368-10549390 CCTGCCACAACATTGTTCAAAGG + Intergenic
1180524522 22:16242956-16242978 CCTGCCCCAAAATTGTTCAAAGG + Intergenic
1182396194 22:30037961-30037983 CCTTCCCCTTCATTTGTTAATGG + Intergenic
1182829039 22:33289971-33289993 CCTACCCCTTCATTTGGCATAGG - Intronic
1184186287 22:42867477-42867499 CCAACCCCCTCATAGTTCATGGG - Intronic
1203236712 22_KI270732v1_random:9649-9671 CCTGCCACAACATTGTTCAAAGG + Intergenic
1203323889 22_KI270737v1_random:98084-98106 CCTGCCACAACATTGTTCAAAGG - Intergenic
949152672 3:789401-789423 CCAACCCCCTTGTTGTTCAAGGG - Intergenic
949198576 3:1343323-1343345 CCAACCCCTGCATTGTTCAAAGG + Intronic
949335463 3:2969971-2969993 CTAACCCCTTAGTTGTTCAAGGG - Intronic
949522002 3:4865418-4865440 CTAACCCCTGCATCGTTCAAAGG - Intronic
949647680 3:6116259-6116281 CCTAATCCTGCATTGTTCAAAGG - Intergenic
949807774 3:7974371-7974393 CCTACCCCTTCCTTGCTGGATGG - Intergenic
951047907 3:18062168-18062190 CCTACCCTTTCATTTTGCACTGG + Intronic
951170491 3:19536289-19536311 CCTTGCCCCTCATTGTTCAGTGG - Intergenic
952464413 3:33565984-33566006 CTAACCTCCTCATTGTTCAAGGG + Intronic
953268671 3:41418134-41418156 CCTAACCCTGTGTTGTTCAAGGG - Intronic
953532469 3:43750976-43750998 CTTATCCATTCATTGGTCAATGG + Intergenic
953965441 3:47301634-47301656 CCAACCCCCACATTGTTCAAGGG - Intronic
954412709 3:50377979-50378001 CCCACCCCTTCCTTGTCCAGAGG + Intronic
955589477 3:60519393-60519415 CTTGCCCCTTAATTGTTCAAGGG - Intronic
956495025 3:69815730-69815752 CTAACCCCTACATTGTTCAAGGG + Intronic
957427745 3:80062909-80062931 CCAACCTCTGCATTGTTCAAGGG - Intergenic
958964758 3:100546964-100546986 CTAACCCCTGCATTGTTCAAGGG - Intronic
959110065 3:102112091-102112113 CCAACCCCTGCATTATTCAAAGG + Intronic
959235408 3:103715572-103715594 CTAACCCCCACATTGTTCAAGGG - Intergenic
959601332 3:108189701-108189723 CCAACCTCTGCATTGTTCGAGGG - Intronic
961014406 3:123456596-123456618 CTAACCCCTGCATTGTTCAAGGG + Intergenic
961965620 3:130899193-130899215 CCAACCCCCACATTGTTCAAGGG - Intronic
962162718 3:133016172-133016194 CCAACCCCTGCATTGTTCAAGGG + Intergenic
962545503 3:136430216-136430238 CTAACCCCTGCATTGTTCAAGGG + Intronic
962708910 3:138069453-138069475 CTGACCCCTGCATTGTTCAAGGG + Intronic
963152678 3:142062336-142062358 CCAACCACTGCGTTGTTCAAGGG + Intronic
963810310 3:149770290-149770312 CTAACCCCTGCATTGTTCAAAGG + Intronic
965187106 3:165478935-165478957 CCAACCCCAACATTGTCCAATGG - Intergenic
966370701 3:179248346-179248368 CTAACCCCTGAATTGTTCAAGGG - Intronic
966401459 3:179551858-179551880 CTAACCCCTGCATTGTTCAAGGG + Intergenic
966488096 3:180493529-180493551 CTTACCTCTACTTTGTTCAAAGG - Intergenic
966699734 3:182834779-182834801 CTAATCCCTGCATTGTTCAAGGG - Intronic
966760412 3:183413159-183413181 CCAGCTCCTACATTGTTCAAAGG - Intronic
967232510 3:187353672-187353694 CTAACCCCCACATTGTTCAAGGG - Intergenic
967313599 3:188129954-188129976 CTAACCCCTGCATTGTTCAAGGG - Intergenic
967368543 3:188716195-188716217 ACTAGGCCTTCATTTTTCAAAGG + Intronic
967523792 3:190468638-190468660 CTTCAACCTTCATTGTTCAAGGG + Intergenic
969138650 4:5050963-5050985 CTGACCCCTTCATTGTACATGGG - Intergenic
969649831 4:8459252-8459274 CCAACCCCCACTTTGTTCAAGGG + Intronic
969665618 4:8555773-8555795 CCTAACCCCACATTATTCAAGGG + Intergenic
971032676 4:22658069-22658091 CCTAACCCTGGGTTGTTCAAGGG + Intergenic
971627775 4:28945133-28945155 CCAACCCCTGAATTGTTCAAGGG - Intergenic
971796339 4:31233581-31233603 CTTACCCCTGTGTTGTTCAATGG - Intergenic
971862792 4:32129771-32129793 CTTACCCCTATGTTGTTCAAGGG - Intergenic
972086145 4:35219171-35219193 CCAACCTCGGCATTGTTCAATGG + Intergenic
972159709 4:36208564-36208586 CCTACCCCTTCCTTATGCAGTGG - Intronic
973930017 4:55782724-55782746 CTAACCCCTACATTGTTAAAGGG + Intergenic
974325282 4:60406309-60406331 CTAACCCTCTCATTGTTCAAGGG + Intergenic
974495717 4:62624127-62624149 CTAATCCCTGCATTGTTCAAGGG - Intergenic
974506100 4:62774157-62774179 CTAACCCTTGCATTGTTCAAGGG - Intergenic
975795216 4:77999847-77999869 CCTAACCTTTCATTGTTCAAGGG - Intergenic
975832303 4:78382386-78382408 ACCACCCCTTCCTTGTTCAGGGG - Intronic
975842442 4:78489196-78489218 CTATCCCCTGCATTGTTCAAGGG - Intronic
976153658 4:82119244-82119266 CTAACCACTGCATTGTTCAATGG - Intergenic
978051870 4:104210998-104211020 CCTACCTCTTGATAGTTCAGAGG - Intergenic
978348492 4:107797127-107797149 CCTACCTCTTCATTTTTCATAGG + Intergenic
978469287 4:109045316-109045338 CTCACCCCCACATTGTTCAAGGG + Intronic
978603357 4:110451305-110451327 CTAACCTCTGCATTGTTCAAAGG - Intronic
979038108 4:115751509-115751531 CCTAACCCCTGGTTGTTCAAGGG - Intergenic
979096342 4:116555583-116555605 CCAACTCTTGCATTGTTCAAGGG + Intergenic
980701548 4:136438482-136438504 CCTACCCCTGTGTTGCTCAAGGG + Intergenic
982111512 4:152060636-152060658 CCAACCCCTGCGTTGTTCAAGGG - Intergenic
982425403 4:155252820-155252842 CTAACCCTTGCATTGTTCAAGGG - Intergenic
982474015 4:155827921-155827943 CCAACCCTTGTATTGTTCAAGGG + Intergenic
982846755 4:160262919-160262941 CTAACCCCTGCATTGTTCAAGGG - Intergenic
983344818 4:166514777-166514799 CCAAGCCCCTCATTGTTCAAGGG - Intergenic
983640322 4:169939165-169939187 CTAACTCCTGCATTGTTCAAGGG - Intergenic
983692403 4:170486798-170486820 CTAACCCCCACATTGTTCAAGGG - Intergenic
983895583 4:173077939-173077961 CTAACTCCTTCATTATTCAAGGG - Intergenic
984840145 4:184060499-184060521 CCTACCCCTGTCTTGTTAAAGGG - Intergenic
984984383 4:185313706-185313728 CTAACCCCCACATTGTTCAAGGG - Intronic
987590918 5:19924923-19924945 CCAATCCCTGCCTTGTTCAAGGG - Intronic
987664441 5:20918951-20918973 CCAACCCCTACACTGTTCAAAGG - Intergenic
987754692 5:22085656-22085678 CCTTCCCTTATATTGTTCAATGG - Intronic
988758242 5:34283242-34283264 CCAACCCCTACACTGTTCAAAGG + Intergenic
989650047 5:43677879-43677901 CTAACCCCTACATTGTTCAAGGG - Intronic
989978534 5:50613680-50613702 CCTAACCCTATGTTGTTCAAGGG + Intergenic
990863598 5:60355547-60355569 CCAACCCCCACCTTGTTCAAGGG - Intronic
992369110 5:76124497-76124519 CCTAGACATTCATTGGTCAATGG + Intronic
992485964 5:77195543-77195565 CTTACCCCCACAGTGTTCAAGGG - Intergenic
993064912 5:83086236-83086258 CTAACCCCTATATTGTTCAAGGG - Intronic
994130011 5:96216307-96216329 CTAACCCCCACATTGTTCAAGGG + Intergenic
995498326 5:112773425-112773447 CCAATCCCTGAATTGTTCAAGGG - Intronic
995634107 5:114165895-114165917 CCTAACCCCACATTTTTCAAGGG + Intergenic
995834994 5:116391341-116391363 CTAGCCCCTTCAGTGTTCAAGGG + Intronic
995952696 5:117735613-117735635 CCAACCCCTTCATTGTTCAAGGG + Intergenic
997177559 5:131795551-131795573 CCTGCACTTTCATTTTTCAAAGG + Intronic
997550840 5:134751762-134751784 CCTCCACCTTCCTGGTTCAAGGG + Exonic
999244321 5:150145404-150145426 CCAGCCCCCTCATTGTTCAAGGG + Intronic
999466335 5:151809637-151809659 ACAACCCCTTCATTTTACAAAGG + Exonic
1000161885 5:158605792-158605814 CTAACTCCTGCATTGTTCAAAGG - Intergenic
1000924827 5:167180520-167180542 CTAACCCCTGTATTGTTCAATGG - Intergenic
1001383747 5:171320974-171320996 CTAACCCCCACATTGTTCAAGGG + Intergenic
1001663629 5:173414659-173414681 CCAACCCCTGCGTTGTTCAAGGG + Intergenic
1002913786 6:1511846-1511868 TCTACCCCCACACTGTTCAAGGG + Intergenic
1003812361 6:9798864-9798886 CGTACCCCGTCATTGTTGAGTGG - Intronic
1004576016 6:16895784-16895806 CCCAAACCTGCATTGTTCAAGGG + Intergenic
1005069368 6:21850332-21850354 CCTACCCCCACATTGTTTAAGGG + Intergenic
1005469974 6:26153678-26153700 CCTCCGCCTTCCTGGTTCAAGGG + Intergenic
1005853909 6:29845771-29845793 CCTTCCCCTTCCTTGTCCAGGGG + Intergenic
1007732878 6:43960177-43960199 CCAGCCTCTGCATTGTTCAAGGG + Intergenic
1009633609 6:66234153-66234175 CCTACCCCTCCATTGTTCAAGGG - Intergenic
1009708366 6:67285068-67285090 CTTACCCAGTGATTGTTCAATGG - Intergenic
1011636292 6:89377263-89377285 CCAACCCCTGTGTTGTTCAAGGG + Intronic
1011920309 6:92566391-92566413 CAAACCCCTGCATTATTCAAAGG + Intergenic
1012286818 6:97400564-97400586 CTAACCCTTTCTTTGTTCAAGGG - Intergenic
1012637708 6:101565709-101565731 CTATCCCCTGCATTGTTCAAGGG - Intronic
1012857008 6:104513972-104513994 ACAACCCTTGCATTGTTCAAGGG - Intergenic
1012969085 6:105707399-105707421 CTCACCCCTGTATTGTTCAAGGG + Intergenic
1013000473 6:106017225-106017247 CCAACCCCCTCATTGCTCAATGG + Intergenic
1013059650 6:106620520-106620542 CCAACTCCTGCATTGTTCAGGGG + Intronic
1013166183 6:107594430-107594452 CCGTCCCCTTCACTGTTCAAAGG - Intronic
1013294925 6:108750577-108750599 CCTACCTGTCCATTGTTCACTGG + Intergenic
1013437239 6:110122875-110122897 CTTACCCCTACACTGTTCAAGGG + Intronic
1013554489 6:111242047-111242069 CCAACCCCTGCATTGTTCAATGG - Intergenic
1013814590 6:114082946-114082968 CCTTCCCCTCCCTTGTCCAAGGG + Intronic
1013856523 6:114580263-114580285 CTAACCCCTACATTGTTCAAGGG - Intergenic
1013901172 6:115157469-115157491 CTAACCCCCACATTGTTCAAGGG + Intergenic
1014041761 6:116835402-116835424 CTAACCCCTGCATTGTCCAAGGG + Intergenic
1014269830 6:119324466-119324488 CCAATCCCTGCATTGTTCAAGGG + Intronic
1014311791 6:119812888-119812910 CTAACCCTTGCATTGTTCAAGGG - Intergenic
1014693645 6:124592496-124592518 CCTAACACTTCACTGTTGAAAGG + Intronic
1015097360 6:129431549-129431571 CCAACCCCTGCATTGGTCAAGGG - Intronic
1015255480 6:131174880-131174902 CCAATCCCCACATTGTTCAAAGG - Intronic
1016064287 6:139662964-139662986 CTAACCCCTACATTGTTCAAGGG - Intergenic
1016236673 6:141876052-141876074 CTAACCCCACCATTGTTCAAAGG - Intergenic
1016733522 6:147451499-147451521 CCTACCCCTGAATTGTTCAAGGG - Intergenic
1017652177 6:156593763-156593785 CTAACCCCCACATTGTTCAAGGG + Intergenic
1017795809 6:157843242-157843264 CTAACCCCCACATTGTTCAAGGG - Intronic
1018570789 6:165207578-165207600 CCTAACTCCACATTGTTCAAGGG - Intergenic
1019029974 6:169001486-169001508 CCTAACCCTGCCTTGCTCAAGGG - Intergenic
1019900926 7:4020136-4020158 CCTGACCCTTCTTTGTTCGAGGG + Intronic
1021352728 7:19615326-19615348 CTAAGCCCTGCATTGTTCAAGGG - Intergenic
1021571610 7:22071521-22071543 CTAACCTCTGCATTGTTCAAGGG + Intergenic
1023375563 7:39552028-39552050 CTAACCCTTGCATTGTTCAAGGG + Intergenic
1023559696 7:41460826-41460848 CCTACCCATTCATCTGTCAATGG - Intergenic
1024407176 7:48995145-48995167 CCGACCCCCTCATTGTTCAAGGG - Intergenic
1024806222 7:53144140-53144162 CCTGCCACAACATTGTTCAAAGG - Intergenic
1025479824 7:60968389-60968411 CCTGCCACATCATTGTTCAAAGG + Intergenic
1025489092 7:61089454-61089476 CCTGCCACAACATTGTTCAAAGG - Intergenic
1025552137 7:62263946-62263968 CCTGCCACAACATTGTTCAAAGG - Intergenic
1025557943 7:62333074-62333096 CCTGCCACAACATTGTTCAAAGG - Intergenic
1025564736 7:62419717-62419739 CCTGCCACAACATTGTTCAAAGG + Intergenic
1025623708 7:63198612-63198634 CTTACCCCTGCATTGTTCAAAGG - Intergenic
1025886142 7:65595111-65595133 CCTGCCACAACATTGTTCAAAGG - Intergenic
1026541971 7:71287541-71287563 CTAACCCCTGCATTGTTAAAGGG - Intronic
1027378381 7:77577089-77577111 CCCACCCCTTCTTTGCTCTATGG + Intronic
1027571712 7:79876475-79876497 CCACCCCCCACATTGTTCAAGGG - Intergenic
1028017118 7:85730091-85730113 CCTAACACTGCATTCTTCAAGGG + Intergenic
1028058373 7:86277523-86277545 CTAACTCCTTCATTGTTCAAGGG + Intergenic
1028455815 7:91036844-91036866 CCAACCCCTGCATTGTTCAAGGG + Intronic
1028628902 7:92911463-92911485 CCGACCTCTGCATTGTTCAAGGG + Intergenic
1029012708 7:97279191-97279213 TTAAACCCTTCATTGTTCAAAGG - Intergenic
1030131273 7:106203408-106203430 CTAGCCCCTGCATTGTTCAAGGG - Intergenic
1030364244 7:108627526-108627548 GCTACCCATTCATAGTTCAGTGG - Intergenic
1030923065 7:115416706-115416728 CCAACCCCTGTGTTGTTCAAGGG - Intergenic
1031050574 7:116940877-116940899 CCTAACCCCGCATTGTTCAAAGG + Intergenic
1031060668 7:117047879-117047901 CTAACCCCTGCACTGTTCAAGGG - Intronic
1031165898 7:118226329-118226351 CCAACCCCTACATTGTTCAAGGG - Intronic
1031537379 7:122952067-122952089 CCAACCCCCACATTGTTCTAGGG - Intergenic
1032226688 7:130037645-130037667 ACCACCCTTTCATTGATCAAAGG + Intronic
1032867193 7:135938067-135938089 TAAACCCCTGCATTGTTCAAGGG + Intronic
1033187815 7:139245238-139245260 CCTACCACATTATTCTTCAATGG + Intronic
1033429431 7:141275513-141275535 CCTTCCCCTACAGGGTTCAAAGG - Intronic
1033706862 7:143897566-143897588 CCGACTGCTCCATTGTTCAATGG + Intronic
1034047834 7:147948697-147948719 CTAACCCCTGCATTGTCCAAGGG - Intronic
1034608898 7:152346619-152346641 CTAACCCTCTCATTGTTCAAGGG - Intronic
1036450240 8:8859860-8859882 CCAATGCCTGCATTGTTCAAGGG + Intronic
1036532908 8:9612721-9612743 CTAACCCCTGCATTGTTCAAGGG - Intronic
1036771567 8:11581951-11581973 CCTCCGCCTCCAGTGTTCAAGGG - Intergenic
1037189631 8:16107544-16107566 CCAACCTCTGCATTGTTCAAGGG + Intergenic
1037908917 8:22731976-22731998 CATACCCCCTCATTGTTTAAGGG + Intronic
1038074354 8:24054388-24054410 AAAACCCCTGCATTGTTCAAGGG - Intergenic
1038394421 8:27236633-27236655 CCCACCCCGTCATTGTTCCCCGG + Exonic
1039366996 8:36939278-36939300 CTAACCCCTGTATTGTTCAAGGG + Intergenic
1040636536 8:49280868-49280890 CTAACTCCTACATTGTTCAAGGG - Intergenic
1040639763 8:49319817-49319839 CTAACCCCTGCATTGTTCAAGGG - Intergenic
1040856916 8:51958141-51958163 CTAACTCCTACATTGTTCAAAGG + Intergenic
1041335956 8:56783764-56783786 CTGACCCCTGCATTGTTCAAGGG + Intergenic
1041353499 8:56974283-56974305 CCAACCCCTGCACTGTTCATGGG + Intronic
1041407715 8:57518505-57518527 ACAGCCCCTTCATTGTTCAAGGG - Intergenic
1041525849 8:58804684-58804706 CCGACCCCTGCATTGTTCGAGGG + Intergenic
1041641383 8:60206664-60206686 CCTGCCCCTTCATCATTAAATGG + Intronic
1042054263 8:64747334-64747356 CCAACCTCTACCTTGTTCAAAGG - Intronic
1042664951 8:71194488-71194510 CTAACCCCTGCCTTGTTCAAGGG - Intergenic
1042868864 8:73379637-73379659 TTAACCCCTGCATTGTTCAAGGG + Intergenic
1043224429 8:77706111-77706133 CTAACTTCTTCATTGTTCAAGGG - Intergenic
1044030925 8:87236219-87236241 CTTACCCCCTTATTCTTCAAAGG + Intronic
1044544272 8:93442241-93442263 CCTCCACCTCCCTTGTTCAAGGG - Intergenic
1045321259 8:101083459-101083481 CCTCCGCCTTCCTGGTTCAAGGG + Intergenic
1045451487 8:102331253-102331275 CTAACCCCTTCATAGTTCAAGGG + Intronic
1045520279 8:102897283-102897305 CCTTTCCCTTCATTGTTCCTAGG - Intronic
1045569617 8:103355407-103355429 TCTACCCCTTCATGGTTTCATGG - Intergenic
1045745317 8:105412211-105412233 CCTTCCCCTTCATTTTTCAATGG + Intronic
1046165844 8:110433782-110433804 CCAACCCCTACATTATTCAATGG - Intergenic
1046580396 8:116085537-116085559 CCTTCTCCTTCAGTATTCAATGG + Intergenic
1048688791 8:136934834-136934856 CTAACCCTTGCATTGTTCAAGGG + Intergenic
1049831266 8:144702464-144702486 CCAACCCCTTTATTATTCAAGGG - Intergenic
1050600136 9:7242285-7242307 CTAATCCCTGCATTGTTCAAGGG + Intergenic
1051368789 9:16340613-16340635 CCTATCCCTTGAGTGTCCAAAGG - Intergenic
1053316252 9:37054334-37054356 CCTACCCTGTCATTTTACAAAGG + Intergenic
1053699412 9:40673929-40673951 CCTGCCACAACATTGTTCAAAGG - Intergenic
1053945408 9:43304073-43304095 CCTGCCACAACATTGTTCAAAGG - Intergenic
1054310701 9:63473330-63473352 CCTGCCACAACATTGTTCAAAGG - Intergenic
1054409491 9:64797481-64797503 CCTGCCACAACATTGTTCAAAGG - Intergenic
1054442652 9:65281292-65281314 CCTGCCACAACATTGTTCAAAGG - Intergenic
1055073454 9:72190621-72190643 CTAACCCCTGCATTATTCAAGGG + Intronic
1055205500 9:73724501-73724523 ACTAACCTTACATTGTTCAAGGG + Intergenic
1056340636 9:85627996-85628018 CCAACCTCTGCATTGTTCAAGGG + Intronic
1056504887 9:87249035-87249057 CCATCCCTTTCAATGTTCAAAGG - Intergenic
1056964423 9:91154115-91154137 CTAACCCCTGCATTGTTCAAGGG - Intergenic
1057513796 9:95703831-95703853 CTAACCACTACATTGTTCAAGGG + Intergenic
1057626459 9:96681990-96682012 CTAACCCCTGCATTGTTCAAGGG - Intergenic
1057952314 9:99379327-99379349 CCAAGCCCCACATTGTTCAAGGG + Intergenic
1058291825 9:103252018-103252040 CTAACCCCTGCATTGTTCAAGGG - Intergenic
1058320399 9:103622909-103622931 CTTGCCCCCACATTGTTCAAGGG + Intergenic
1058682460 9:107452076-107452098 CCTCCCCCTTGATTGTTGAGGGG - Intergenic
1059898773 9:118898707-118898729 CAAACCCCTGCGTTGTTCAAAGG - Intergenic
1060005481 9:119995897-119995919 CTTACCTCTGCATTGTTTAAGGG - Intergenic
1060297582 9:122353660-122353682 GCCACCCCTGCATTGTTTAAGGG + Intergenic
1060610685 9:124961733-124961755 CTAACCCCTGCATTGTTCAGGGG - Intronic
1062061772 9:134500869-134500891 CCGACCCCCTCGTGGTTCAAGGG + Intergenic
1203580743 Un_KI270746v1:981-1003 CCTGCCACAACATTGTTCAAAGG + Intergenic
1203588543 Un_KI270747v1:32651-32673 CCTGCCACAACATTGTTCAAAGG - Intergenic
1203614783 Un_KI270749v1:49985-50007 CCTGCCACAACATTGTTCAAAGG + Intergenic
1185882259 X:3751870-3751892 CCTACATCTACATTGTTGAATGG - Intergenic
1185921731 X:4100538-4100560 CTAACCCCTGCATTGTCCAAAGG - Intergenic
1186238916 X:7545797-7545819 CTTTCTCCTTCTTTGTTCAATGG - Intergenic
1187342745 X:18435921-18435943 CTAACCCCTACCTTGTTCAAGGG - Intronic
1188632041 X:32375878-32375900 CCTTCCCCTTCCTTTTTAAAGGG + Intronic
1190814757 X:53920119-53920141 CTTAACCCTGCATTGTTCAAAGG - Intergenic
1190823922 X:53999490-53999512 CCAACCTCCACATTGTTCAAGGG + Intronic
1192459743 X:71306882-71306904 CCCAACCTTGCATTGTTCAAGGG - Intergenic
1193744609 X:85260774-85260796 TTAACCCCTGCATTGTTCAAGGG - Intronic
1195208462 X:102626750-102626772 CCTTCCCCCTCATTCTTCATAGG + Intergenic
1195506591 X:105665183-105665205 CTAACCCCTGCATTGTTCAAGGG + Intronic
1195517509 X:105794217-105794239 AATACCCCTGCATTGTTCAAAGG - Intergenic
1195636727 X:107125415-107125437 CTAAACCCTTCATTGTTGAAGGG + Intronic
1198673754 X:139109854-139109876 CCAAGCCCTTCATTTCTCAAAGG + Intronic
1199391143 X:147280700-147280722 CCTTCCCCTCCATTTCTCAAGGG + Intergenic
1199391360 X:147283398-147283420 CCTTCCCCTCCATTTCTCAAGGG + Intergenic
1199391578 X:147286097-147286119 CCTTCCCCTCCATTTCTCAAGGG + Intergenic
1199498943 X:148487967-148487989 CCAACCCCTGTGTTGTTCAAGGG + Intergenic
1199674297 X:150172834-150172856 TTTACCCCTTCATCATTCAATGG + Intergenic
1200301708 X:154983054-154983076 CCAACCCCCACATTGTTCAAGGG + Intronic
1200852161 Y:7894321-7894343 TCTACCCCTTCACTGGCCAAGGG + Intergenic
1201458097 Y:14193377-14193399 CTTTCTCCTTCTTTGTTCAATGG - Intergenic
1201607500 Y:15803255-15803277 CCTCCCCCTTCTGGGTTCAAGGG - Intergenic