ID: 1108011443

View in Genome Browser
Species Human (GRCh38)
Location 13:46017085-46017107
Sequence CGTGTAGTGACTCCAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108011443_1108011445 0 Left 1108011443 13:46017085-46017107 CCAGATTTTGGAGTCACTACACG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1108011445 13:46017108-46017130 TACGACGTTAATGAAGCACTGGG 0: 1
1: 0
2: 0
3: 2
4: 21
1108011443_1108011444 -1 Left 1108011443 13:46017085-46017107 CCAGATTTTGGAGTCACTACACG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1108011444 13:46017107-46017129 GTACGACGTTAATGAAGCACTGG 0: 1
1: 0
2: 0
3: 0
4: 27
1108011443_1108011446 21 Left 1108011443 13:46017085-46017107 CCAGATTTTGGAGTCACTACACG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1108011446 13:46017129-46017151 GGTGCATGATTTCATCTAGAAGG 0: 1
1: 0
2: 2
3: 14
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108011443 Original CRISPR CGTGTAGTGACTCCAAAATC TGG (reversed) Intronic
906271635 1:44483990-44484012 AGTGAAATGTCTCCAAAATCTGG + Intronic
909479820 1:76119143-76119165 TGTGAAGTGACTACAAACTCAGG - Intronic
1075222149 10:120594207-120594229 CATTTAGTGATTCCAAACTCTGG + Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1086407471 11:86510753-86510775 AGTGCAGTGGCTCTAAAATCAGG - Intronic
1096164794 12:49413323-49413345 CGTGTAGTCACTCCAGCATAGGG + Intronic
1100780699 12:98023149-98023171 AGTGTAGTTACTCAAGAATCTGG - Intergenic
1101229480 12:102725266-102725288 CCTGTAATAAGTCCAAAATCAGG - Intergenic
1104485407 12:129147915-129147937 CGTGTGATGGCTTCAAAATCAGG + Intronic
1108011443 13:46017085-46017107 CGTGTAGTGACTCCAAAATCTGG - Intronic
1115145684 14:30223483-30223505 CTGGTGGTGACTCAAAAATCAGG + Intergenic
1117746257 14:58872619-58872641 CATTGAGTGCCTCCAAAATCAGG + Intergenic
1125973600 15:43932290-43932312 CTTGTAGTGTCCCCAAGATCTGG + Intronic
1137354093 16:47742328-47742350 GGTGTAGTAAGTCCAAAGTCTGG + Intergenic
1142477040 17:194633-194655 CGTGTAGAGCCTCGTAAATCAGG + Intergenic
1147795906 17:43042625-43042647 CGTGTATTAACTCCATCATCAGG + Intergenic
926444128 2:12923235-12923257 TGTGTAATGAATTCAAAATCTGG + Intergenic
926447388 2:12960346-12960368 TGTGTAGTAAATCCAATATCTGG + Intergenic
931652713 2:64482983-64483005 GGTGTGATGACTCCAACATCAGG - Intergenic
936966724 2:118134421-118134443 TGAGTAGTGACTCCAATATGTGG - Intergenic
954538271 3:51377451-51377473 CGTGCAGTGACTCCCAGATCAGG + Intronic
961758381 3:129145750-129145772 CATGTACTCACTCCATAATCAGG + Exonic
967605364 3:191438609-191438631 TTTTTAGTGACTCCAAAATTTGG + Intergenic
969170959 4:5362937-5362959 TGTGTTGTCACTCCAAACTCAGG + Intronic
971071568 4:23098857-23098879 GGCTTAGTGAGTCCAAAATCTGG - Intergenic
979447690 4:120834097-120834119 CGTGGAGGGACTGAAAAATCAGG + Intronic
979654292 4:123174190-123174212 AGTGTAGTCACTGCTAAATCTGG - Intronic
983897153 4:173093451-173093473 TGTCTAGTAACTCCAACATCTGG + Intergenic
992262311 5:74983647-74983669 GGTGTCCTGACTCCAAAAGCTGG + Intergenic
995389499 5:111624949-111624971 AGTGTAGTGCCACCAAGATCTGG - Intergenic
1000639497 5:163684942-163684964 AGTGGAGTGAGTCTAAAATCTGG + Intergenic
1005962400 6:30703515-30703537 GATGTCGTGACTCCAAAACCAGG - Exonic
1015609616 6:135002380-135002402 CGGGGACTCACTCCAAAATCTGG + Intronic
1021364154 7:19755614-19755636 CTTGTAGTGACACCAGAAACAGG - Intronic
1024474165 7:49792753-49792775 TGTGCAGTGACTCCAACATCTGG - Intronic
1024965834 7:55021014-55021036 CGTCTAGTGATCCCCAAATCTGG - Intronic
1034138147 7:148790772-148790794 CAGGTAGTGACTTCAAAAGCTGG + Intronic
1044423075 8:92021327-92021349 TATGTAGTGACTCCAATGTCTGG + Intronic
1052742049 9:32402819-32402841 CTTGAAGTGGCTCCAAATTCCGG + Intronic
1060054788 9:120404035-120404057 CAGGCAGTGACACCAAAATCAGG - Exonic
1186294377 X:8132975-8132997 CATGTAGTGCCTCTTAAATCAGG + Intergenic
1189629767 X:42940692-42940714 CCTGTAATGCCTCCAAAATGTGG + Intergenic
1197179500 X:123518958-123518980 CATGTATTAACTTCAAAATCTGG + Intergenic