ID: 1108013054

View in Genome Browser
Species Human (GRCh38)
Location 13:46041173-46041195
Sequence CTCATCAGTGATGGATATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 860
Summary {0: 1, 1: 0, 2: 8, 3: 71, 4: 780}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108013054 Original CRISPR CTCATCAGTGATGGATATTT GGG (reversed) Intronic
900918373 1:5654397-5654419 ATCCTCACTGATGGACATTTGGG - Intergenic
902590501 1:17470619-17470641 CACAGCAGTGATGAATATTCAGG + Intergenic
903341305 1:22656356-22656378 CTCATCATTGGTGGACATTTGGG - Intronic
904800687 1:33091089-33091111 TTCATCTGTGATGGACACTTAGG + Intronic
905299165 1:36974434-36974456 TTCATCAAGGATGGACATTTGGG - Intronic
905354966 1:37375415-37375437 TCTATCATTGATGGATATTTGGG + Intergenic
905546759 1:38806233-38806255 TTCATCACTGATGGACATTTGGG - Intergenic
905604912 1:39289133-39289155 TTCATCTGTGATGGACACTTAGG + Intronic
906355358 1:45101639-45101661 TCTATCACTGATGGATATTTGGG - Intronic
906368540 1:45232576-45232598 CTCATCAGTGATGTTCACTTTGG + Intronic
906893790 1:49748403-49748425 GTCATCATTGATGGGCATTTTGG + Intronic
908630400 1:66099361-66099383 CCTATCATTGATGGGTATTTGGG + Intronic
909053533 1:70796099-70796121 TTTATCATTGATGGACATTTGGG + Intergenic
909343513 1:74558170-74558192 TCTATCATTGATGGATATTTGGG - Intergenic
909374293 1:74922624-74922646 CCTATCATTGATGGACATTTGGG - Intergenic
909678555 1:78265257-78265279 CCTATCACTGATGGACATTTGGG + Intergenic
909713648 1:78680692-78680714 TTTATCATTGATGAATATTTGGG + Intergenic
909991935 1:82234190-82234212 CTTATCATTGATGGGCATTTAGG + Intergenic
910223128 1:84909206-84909228 TCCATCATTGATGGACATTTGGG - Intergenic
910481963 1:87668764-87668786 TCTATCATTGATGGATATTTGGG - Intergenic
911170267 1:94764198-94764220 TCCATCATTGATGGACATTTGGG - Intergenic
911227549 1:95323576-95323598 CTCATTAATCATGGATTTTTGGG + Intergenic
911433883 1:97830141-97830163 TTTATCATTGATGGACATTTGGG + Intronic
911675860 1:100657294-100657316 CTCTTTAGGGATGGATTTTTGGG - Intergenic
911714388 1:101114237-101114259 TCCATCACTGATGGACATTTGGG - Intergenic
911756436 1:101562028-101562050 ATCATCAGAGAGGGATTTTTAGG + Intergenic
911823987 1:102457580-102457602 TTGATCATTGATGGACATTTGGG - Intergenic
911882919 1:103264697-103264719 TCTATCATTGATGGATATTTGGG - Intergenic
911963084 1:104332394-104332416 TCTATCACTGATGGATATTTGGG + Intergenic
911966312 1:104376277-104376299 TCTATCACTGATGGATATTTGGG - Intergenic
911970507 1:104429591-104429613 TCTATCACTGATGGATATTTGGG - Intergenic
912464454 1:109861730-109861752 CCTATCATTGATGGATATTTGGG - Intergenic
912592144 1:110834048-110834070 TTTATCACTGATGGACATTTGGG + Intergenic
912894033 1:113566329-113566351 TTCACCAATGATGGAAATTTGGG - Intronic
912973802 1:114309705-114309727 GTCATCATTGTTGGACATTTGGG - Intergenic
913279361 1:117171246-117171268 CCTATCATTGATGGACATTTGGG + Intronic
913362628 1:117999222-117999244 TCTATCATTGATGGATATTTGGG + Intronic
915246983 1:154563027-154563049 TTCACTATTGATGGATATTTTGG - Intergenic
915700838 1:157794688-157794710 CTCATCACTGGTGGACATTAAGG - Intronic
915891438 1:159777656-159777678 TTTATCACTGATGGACATTTAGG + Intergenic
916013957 1:160731810-160731832 CTTATCATTGATGGGCATTTGGG + Intergenic
916207622 1:162330885-162330907 CTCCTGAGTGATGGCTATTGGGG + Intronic
916645319 1:166778962-166778984 TCTATCATTGATGGATATTTGGG + Intergenic
917230922 1:172836991-172837013 TTTATCATTGATGGACATTTGGG - Intergenic
917248878 1:173035598-173035620 CCTATCACTGATGGGTATTTGGG - Intergenic
917898719 1:179518782-179518804 TCTATCATTGATGGATATTTAGG + Intronic
917999544 1:180479243-180479265 TTCATCCGTGATAGACATTTAGG - Intronic
918537677 1:185592104-185592126 TCTATCATTGATGGATATTTGGG - Intergenic
918637484 1:186795778-186795800 TCAATCAGTGATGGACATTTGGG + Intergenic
918637531 1:186796273-186796295 TCAATCAGTGATGGACATTTGGG + Intergenic
918722703 1:187874039-187874061 TCTATCACTGATGGATATTTGGG + Intergenic
918923251 1:190744130-190744152 TTTATCTGTGATAGATATTTGGG - Intergenic
919141595 1:193579515-193579537 CACATCAGTGAGGGATTTCTAGG - Intergenic
919975598 1:202609271-202609293 CTTATCATTGTTGGACATTTGGG + Intronic
920107369 1:203563497-203563519 GTCATCAGTGATGAATATTCTGG + Intergenic
920879864 1:209869823-209869845 CCCATCTTTGAGGGATATTTTGG - Intergenic
921004672 1:211081567-211081589 CCTATCATTGATGGACATTTGGG - Intronic
921098310 1:211906279-211906301 TTCTTCACTGATGGATGTTTAGG - Intergenic
921210338 1:212890823-212890845 CTCACCAGTGATAGACATTTTGG + Intronic
921336992 1:214098150-214098172 TTCACCACTGATGGACATTTAGG - Intergenic
921618478 1:217299549-217299571 TCTATCACTGATGGATATTTGGG + Intergenic
921829022 1:219706473-219706495 TTCATCATTGATGGGCATTTGGG - Intronic
922189977 1:223309844-223309866 CTCATAAATCATGGATAATTTGG + Intronic
923222442 1:231907569-231907591 TCTATCATTGATGGATATTTGGG + Intronic
924829424 1:247577603-247577625 CTAATCACTGATGGATATGTAGG + Exonic
1063625784 10:7688796-7688818 CCTATCATTGATGGGTATTTAGG - Intergenic
1064736046 10:18382782-18382804 TCCATCATTGATGGACATTTGGG + Intronic
1065053888 10:21823474-21823496 CTCATCAGTGATAGAAAAATCGG - Intronic
1065502581 10:26396908-26396930 TTTATCACTGATGGACATTTGGG - Intergenic
1066252321 10:33646615-33646637 CCCACCATTGATGGATACTTAGG - Intergenic
1066701434 10:38133707-38133729 TCTATCATTGATGGATATTTGGG + Intergenic
1067923786 10:50486906-50486928 GTCATCATTGATGGGCATTTAGG - Intronic
1068390202 10:56386128-56386150 TCTATCATTGATGGATATTTGGG + Intergenic
1068404188 10:56568947-56568969 TTTATCATTGATGGACATTTTGG + Intergenic
1068421360 10:56798470-56798492 CACATCAGTGGAGGATAATTTGG - Intergenic
1069136746 10:64776771-64776793 CTAACCAGTGGTGGATATATTGG - Intergenic
1071170955 10:82863253-82863275 TCTATCATTGATGGATATTTGGG + Intronic
1071171707 10:82873454-82873476 CACATCACTCATGAATATTTAGG - Intronic
1071919654 10:90335171-90335193 TCTATCATTGATGGATATTTGGG - Intergenic
1071976734 10:90963186-90963208 TTTATCATTGATGGACATTTGGG + Intergenic
1072393793 10:95017526-95017548 TCTATCATTGATGGATATTTGGG + Intergenic
1072480114 10:95802845-95802867 TCCATCACTGATGGACATTTGGG + Intronic
1072775735 10:98191046-98191068 TTTATCATTGATGGACATTTGGG + Intronic
1073220087 10:101864491-101864513 TCTATCATTGATGGATATTTGGG - Intronic
1074252873 10:111770365-111770387 CTTATCACTGATGGACATTTGGG - Intergenic
1074271484 10:111957906-111957928 CTTATCATTGATGGGCATTTGGG + Intergenic
1074288124 10:112117624-112117646 TTCATAATTGATGGACATTTGGG + Intergenic
1074809564 10:117090159-117090181 TTCATTATTGATGGACATTTGGG - Intronic
1075876047 10:125806592-125806614 TTCATCTGTTAAGGATATTTTGG - Intronic
1076340002 10:129738602-129738624 CACATCATTGATGGGCATTTGGG + Intronic
1077275358 11:1703872-1703894 TCTATCATTGATGGATATTTGGG - Intergenic
1078278760 11:9877789-9877811 CCTATCATTGATGGACATTTGGG + Intronic
1078539669 11:12203155-12203177 TTCATCAGTGGTGGCCATTTAGG + Intronic
1078607881 11:12793380-12793402 GTGATCAGTGCTGGATATTTAGG + Intronic
1079784883 11:24659169-24659191 TTTATCATTGATGGACATTTGGG - Intronic
1079942352 11:26697346-26697368 CTCATCAGTGTTTGAAATGTGGG + Intronic
1080495550 11:32814774-32814796 TTCATCACTGATGGGCATTTGGG - Intergenic
1080515104 11:33013231-33013253 TCTATCATTGATGGATATTTGGG - Intergenic
1080814813 11:35744963-35744985 TCTATCAGTGATGGACATTTGGG + Intronic
1081143473 11:39533064-39533086 TTTATCATTGATGGACATTTGGG + Intergenic
1081377363 11:42375698-42375720 TCCATCATTGATGGACATTTGGG + Intergenic
1081378033 11:42382549-42382571 TCCATCATTGATGGACATTTGGG - Intergenic
1081592365 11:44433423-44433445 CTCATCAATGAAGCATATTGGGG + Intergenic
1081750471 11:45507209-45507231 TTCACTATTGATGGATATTTGGG - Intergenic
1081768772 11:45633322-45633344 TCTATCATTGATGGATATTTGGG - Intergenic
1082297398 11:50458875-50458897 CCTATCATTGATGGACATTTGGG + Intergenic
1082639889 11:55646126-55646148 TCTATCATTGATGGATATTTAGG + Intergenic
1082673082 11:56059054-56059076 CCTATCATTGATGGACATTTTGG - Intergenic
1082951567 11:58821688-58821710 TCTATCATTGATGGATATTTGGG - Intergenic
1083002872 11:59312446-59312468 TCTATCAGTGATGGACATTTGGG - Intergenic
1085188237 11:74594523-74594545 TTCATCATTAATGGACATTTGGG + Intronic
1085594648 11:77798255-77798277 CCTATCATTGATGGACATTTGGG - Intronic
1085745111 11:79108610-79108632 CTCATCGGTGATGCTAATTTTGG - Intronic
1086694679 11:89829316-89829338 CCTATCATTGATGGACATTTTGG - Intergenic
1086711469 11:90015183-90015205 CCTATCATTGATGGACATTTTGG + Intergenic
1086758175 11:90592091-90592113 CCTATCATTGATGGACATTTGGG - Intergenic
1087224288 11:95580530-95580552 CTTATCATTGGTGGACATTTGGG + Intergenic
1087341655 11:96914905-96914927 CTCATCAGTCATTTATCTTTGGG - Intergenic
1087379983 11:97393087-97393109 TTCATCTATGATGGACATTTAGG + Intergenic
1087436456 11:98124815-98124837 TCTATCACTGATGGATATTTGGG + Intergenic
1087697871 11:101401682-101401704 TTTGTCACTGATGGATATTTAGG - Intergenic
1087800801 11:102502049-102502071 CCTATCATTGATGGACATTTGGG + Intergenic
1087995843 11:104807946-104807968 CCTATCATTGATGGACATTTGGG - Intergenic
1088018037 11:105083750-105083772 CCTATCATTGATGGACATTTGGG - Intronic
1088020625 11:105113923-105113945 CCTATCACTGATGGACATTTGGG - Intergenic
1088508393 11:110549177-110549199 CCTATCACTGATGGACATTTGGG + Intergenic
1088572140 11:111232818-111232840 TTTATCATTGATGGACATTTAGG - Intergenic
1088929995 11:114341735-114341757 CCTATTATTGATGGATATTTGGG - Intergenic
1089442184 11:118527019-118527041 TTCATCAGTGATGTATGTTCAGG + Intergenic
1090436635 11:126692587-126692609 TTCATCATTGATGAATACTTGGG - Intronic
1090491758 11:127169377-127169399 TCTATCATTGATGGATATTTGGG + Intergenic
1090515072 11:127416269-127416291 TCCATCATTGATGGACATTTGGG + Intergenic
1091371681 11:135065557-135065579 TCTATCAGTGATGGATATTTGGG + Intergenic
1092678553 12:10950150-10950172 TTTATCACTGATGGACATTTGGG + Intronic
1093597174 12:20975984-20976006 TCTATCATTGATGGATATTTGGG + Intergenic
1093606479 12:21096492-21096514 TCTATCATTGATGGATATTTGGG + Intronic
1094481779 12:30889071-30889093 CCTATCATTGATGGACATTTGGG + Intergenic
1094793011 12:33936155-33936177 CCTATCATTGATGGACATTTGGG - Intergenic
1095078103 12:37958440-37958462 AGAATCTGTGATGGATATTTGGG + Intergenic
1095116782 12:38363742-38363764 TCTATCATTGATGGATATTTGGG - Intergenic
1095523331 12:43094735-43094757 CTATTGAGTGGTGGATATTTGGG + Intergenic
1095606911 12:44079106-44079128 CCTATCATTGATGGACATTTGGG + Intronic
1096930988 12:55210178-55210200 TTTATCACTGATGGACATTTGGG + Intergenic
1096942357 12:55360976-55360998 CCTATCATTGATGGACATTTGGG - Intergenic
1097147021 12:56948785-56948807 CCCATCAGTGCTGGTTATTTGGG + Intergenic
1097299383 12:58002157-58002179 CCTATCATTGATGGACATTTGGG + Intergenic
1097462125 12:59874627-59874649 TTCTTAATTGATGGATATTTGGG - Intergenic
1098434591 12:70454860-70454882 TTTATCATTGATGGACATTTGGG + Intergenic
1099018118 12:77370175-77370197 TCCATCACTGATGGACATTTGGG + Intergenic
1099221687 12:79922440-79922462 TTCATCATTGATGGGGATTTGGG - Intronic
1099499972 12:83402083-83402105 TCTATCATTGATGGATATTTGGG + Intergenic
1099757931 12:86879288-86879310 CCTATCATTGATGGACATTTGGG - Intergenic
1099764746 12:86969262-86969284 TCTATCATTGATGGATATTTGGG + Intergenic
1100104667 12:91155500-91155522 GGTATCAGTGAAGGATATTTTGG + Intronic
1100116061 12:91306014-91306036 TCTATCAGTGATGGGTATTTAGG - Intergenic
1100152022 12:91750178-91750200 GTCATCATTGTTGGACATTTGGG + Intergenic
1100808804 12:98316503-98316525 CCTATCATTGATGGACATTTGGG - Intergenic
1101600731 12:106207191-106207213 TCTATCATTGATGGATATTTGGG + Intergenic
1103156610 12:118690546-118690568 TTCATAAGTGATGGACATTTGGG + Intergenic
1103220975 12:119244854-119244876 CCCATCGGTGATGAATATGTTGG + Intergenic
1103223980 12:119270768-119270790 CTCACCAGGTATGGATATTAAGG + Intergenic
1104096318 12:125561120-125561142 TTTATCATTGATGGACATTTGGG - Intronic
1104730156 12:131100885-131100907 TTAATCAGTGATGTAGATTTAGG + Intronic
1105666628 13:22565697-22565719 TTTATCTGTGATAGATATTTAGG - Intergenic
1106306936 13:28520780-28520802 TTCATTATTGATGGATACTTAGG + Intergenic
1106799219 13:33239273-33239295 CTCATCATCAATGGACATTTAGG + Intronic
1107316828 13:39141325-39141347 TTTATCATTGATGGACATTTGGG + Intergenic
1107399826 13:40058613-40058635 CTCATCATTAATGGGTAGTTTGG - Intergenic
1108013054 13:46041173-46041195 CTCATCAGTGATGGATATTTGGG - Intronic
1108567554 13:51715978-51716000 TTCATCACTGATGGACATTGAGG - Intronic
1108645426 13:52422353-52422375 TTCATCACTGATGGACACTTAGG + Intronic
1109363766 13:61329323-61329345 TCTATCATTGATGGATATTTGGG - Intergenic
1109514029 13:63417788-63417810 TCCATCATTGATGGACATTTGGG - Intergenic
1109891724 13:68622859-68622881 TCTATCATTGATGGATATTTGGG - Intergenic
1109949093 13:69478254-69478276 TCTATCATTGATGGATATTTGGG + Intergenic
1109964391 13:69672558-69672580 TCTATCATTGATGGATATTTGGG - Intergenic
1110069358 13:71153892-71153914 CCAATCATTGATGGACATTTAGG + Intergenic
1110111024 13:71746268-71746290 CTCTTCATTCATGTATATTTTGG - Intronic
1110429584 13:75408347-75408369 TTCATCACGGATGGACATTTGGG + Intronic
1110654259 13:77977866-77977888 TTCATCTGTGATGGACATTTGGG + Intergenic
1111301470 13:86356050-86356072 CCTATCATTGATGGGTATTTAGG + Intergenic
1111407416 13:87826613-87826635 CCTATCATTGATGGGTATTTGGG - Intergenic
1111416946 13:87959168-87959190 TTCATCACTGATGGAAATTTGGG + Intergenic
1112042931 13:95566018-95566040 TCCATCATTGATGGACATTTGGG + Intronic
1112043692 13:95574113-95574135 TCCATCATTGATGGACATTTGGG + Intronic
1112069762 13:95836563-95836585 CTCCTGAGTGCTGGAAATTTAGG + Intronic
1112730752 13:102358917-102358939 TTTATCACTGATGGACATTTGGG - Intronic
1112937540 13:104820142-104820164 CCTATCATTGATGGACATTTGGG - Intergenic
1113954509 13:114090041-114090063 TTAATCACTGATGGATGTTTGGG + Intronic
1114725886 14:24936887-24936909 TCTATCATTGATGGATATTTGGG - Intronic
1114964780 14:27943655-27943677 TCCATCATTGATGGACATTTGGG - Intergenic
1115151484 14:30291287-30291309 CTCTTCAATGATGCCTATTTTGG - Intergenic
1115190235 14:30739983-30740005 TTATTCAATGATGGATATTTGGG - Intergenic
1116107768 14:40532582-40532604 TCTATCATTGATGGATATTTTGG + Intergenic
1116178563 14:41506646-41506668 CTCTTCAGTGAGGGAAACTTTGG + Intergenic
1116362080 14:44012667-44012689 CTTATAAATGATTGATATTTTGG + Intergenic
1116787033 14:49299189-49299211 GTCATCAGTGAAGGATAAATGGG + Intergenic
1117283231 14:54260946-54260968 CTCATCGTTGATGGACACTTAGG + Intergenic
1117367653 14:55046277-55046299 TTCACCAAAGATGGATATTTAGG - Exonic
1117612529 14:57499395-57499417 TCTATCATTGATGGATATTTGGG + Intergenic
1117613965 14:57513879-57513901 TATATCATTGATGGATATTTGGG + Intergenic
1117617738 14:57550980-57551002 TCTATCATTGATGGATATTTGGG + Intergenic
1117784483 14:59268237-59268259 TTCATCATTGATGGACATTTGGG + Intronic
1118033705 14:61842975-61842997 CGCATCTGTGATGGACACTTAGG + Intergenic
1118495051 14:66300206-66300228 TCTATCAGTGATGGACATTTGGG - Intergenic
1118814954 14:69304862-69304884 TTCATCTGTCATGGACATTTGGG + Intronic
1119523683 14:75304956-75304978 TTCATCATTGATGGACATTTGGG + Intergenic
1119597826 14:75952606-75952628 TTCATCAGTTGTGGACATTTGGG - Intronic
1120299001 14:82681437-82681459 TCCATCACTGATGGACATTTGGG + Intergenic
1120507208 14:85367348-85367370 TTTACCATTGATGGATATTTGGG + Intergenic
1120563479 14:86025659-86025681 TCCATCATTGATGGATATTTGGG - Intergenic
1120835932 14:89038332-89038354 TCTATCATTGATGGATATTTGGG - Intergenic
1121234349 14:92381179-92381201 CCTATCATTGATGGACATTTGGG - Intronic
1121768812 14:96512742-96512764 TTCTTTACTGATGGATATTTAGG + Intronic
1121796121 14:96736800-96736822 TTCATCTGTAGTGGATATTTTGG - Intergenic
1121825158 14:97004221-97004243 TTCACCACTGATGGATAGTTAGG - Intergenic
1122467181 14:101941822-101941844 TCTATCATTGATGGATATTTGGG + Intergenic
1122674061 14:103395707-103395729 CTCATACTTGATTGATATTTTGG + Intronic
1122912380 14:104837341-104837363 TCTATCATTGATGGATATTTGGG + Intergenic
1124719284 15:32097900-32097922 GGCAGCAGTGAAGGATATTTGGG + Intronic
1125210205 15:37206127-37206149 CCTATCATTGATGGACATTTGGG - Intergenic
1125755682 15:42063107-42063129 CTCATCAATGATGAAGACTTGGG - Intergenic
1126086484 15:45015104-45015126 TCTATCAGTGATGGACATTTGGG + Intergenic
1126518730 15:49564586-49564608 TTCACCATTGATGGATAGTTAGG - Intronic
1126727656 15:51648772-51648794 CCTATCATTGATGGACATTTGGG - Intergenic
1127167893 15:56266719-56266741 CCTATCATTGATGGACATTTGGG + Intronic
1127816607 15:62615676-62615698 CAAAGCAGTGATGGATATCTTGG + Intronic
1128205637 15:65849392-65849414 CGCATCAGTTAGGGCTATTTTGG - Intronic
1128365600 15:66999472-66999494 TTCATCATTGATGGGCATTTGGG - Intergenic
1128613568 15:69092350-69092372 CTCACCACTGATGGGCATTTGGG - Intergenic
1128623182 15:69169786-69169808 CCTATCATTGATGGACATTTGGG + Intronic
1128927424 15:71670889-71670911 TCTATCAGTGATGGACATTTGGG + Intronic
1129796009 15:78376354-78376376 GTCATCATTGATGGACATTTGGG + Intergenic
1130286169 15:82556663-82556685 CTCATGACTGATTAATATTTGGG - Intronic
1131083690 15:89557584-89557606 CCTATCATTGATGGACATTTGGG + Intergenic
1131114775 15:89788222-89788244 CTCATCATTGATGGGCATTTGGG - Intronic
1131284561 15:91046308-91046330 TCTATCATTGATGGATATTTGGG + Intergenic
1131960155 15:97781771-97781793 CCCATAATTGAGGGATATTTTGG + Intergenic
1131986509 15:98047195-98047217 CCTATCATTGATGGACATTTGGG + Intergenic
1132206767 15:99991770-99991792 TCTATCATTGATGGATATTTGGG - Intronic
1132380843 15:101365654-101365676 TTCACCTGTGATGGACATTTGGG - Intronic
1133414128 16:5593089-5593111 TCTATCATTGATGGATATTTGGG - Intergenic
1134076717 16:11297128-11297150 CTCACTGTTGATGGATATTTGGG - Intronic
1134513479 16:14867817-14867839 ATAATAAGTGATAGATATTTAGG + Intronic
1134701116 16:16266310-16266332 ATAATAAGTGATAGATATTTAGG + Intronic
1134970712 16:18528335-18528357 ATAATAAGTGATAGATATTTAGG - Intronic
1135573828 16:23569605-23569627 CTTCTCAGTGATGGATATATGGG - Intronic
1136617268 16:31405966-31405988 TTCCCCAGTGTTGGATATTTGGG + Intronic
1137546412 16:49407469-49407491 CTGTTGACTGATGGATATTTGGG - Intergenic
1138006816 16:53344813-53344835 TTAATCATTGATGGACATTTGGG + Intergenic
1138696945 16:58822931-58822953 TTTATCATTGATGGACATTTGGG + Intergenic
1138705914 16:58914771-58914793 TCTATCATTGATGGATATTTGGG + Intergenic
1139155386 16:64435179-64435201 CTCATAAACAATGGATATTTTGG + Intergenic
1140611521 16:76605391-76605413 CTTATCACTGATGGGCATTTAGG - Intronic
1141860821 16:86714899-86714921 TTCATCATTGATGGATATTTAGG + Intergenic
1142496403 17:308545-308567 CTCACCTGTGATGGATATTTGGG - Intronic
1143033108 17:3978706-3978728 ATCACCAATGATGGAAATTTGGG - Intergenic
1143684693 17:8504422-8504444 GTGGTCAGTGATGGATATCTAGG - Intronic
1144553621 17:16262811-16262833 CTCATCAGTGACAAACATTTTGG - Intronic
1145235598 17:21205947-21205969 TTCATCTGTGATGGACACTTCGG + Intronic
1145762377 17:27433048-27433070 TTCTTCTGTGATGGGTATTTTGG + Intergenic
1146103602 17:30010199-30010221 TCTATCATTGATGGATATTTGGG + Intronic
1146459128 17:33030714-33030736 ATCATCAGTGATATATATTTTGG + Intronic
1146893210 17:36522127-36522149 CTCAAATCTGATGGATATTTTGG - Intronic
1147270262 17:39264562-39264584 GCAATCAGTGATTGATATTTTGG + Intronic
1149131762 17:53310859-53310881 TCTATCAGTGATGGGTATTTGGG - Intergenic
1149397079 17:56255870-56255892 CTCATTAGAGATAGAAATTTGGG + Intronic
1149437994 17:56650317-56650339 TCTATCACTGATGGATATTTGGG + Intergenic
1150965973 17:69969137-69969159 ATCATCAGTGAAGGATAATCAGG - Intergenic
1151007613 17:70455932-70455954 GTCTTCATCGATGGATATTTGGG + Intergenic
1152973849 18:193830-193852 TTCATCGTTGGTGGATATTTGGG + Intronic
1152982309 18:290090-290112 CCTATCAGTGATGGGCATTTGGG - Intergenic
1153561723 18:6377715-6377737 CCTATCATTGATGGAAATTTGGG + Intronic
1154953508 18:21232473-21232495 TTCATCTGTAATGGATACTTGGG + Intergenic
1155264135 18:24074899-24074921 TCTATCATTGATGGATATTTGGG - Intronic
1155351066 18:24906829-24906851 TCTATCATTGATGGATATTTGGG - Intergenic
1155851452 18:30779810-30779832 TCTATCATTGATGGATATTTGGG + Intergenic
1156073889 18:33248659-33248681 TCCATCATTGATGGACATTTGGG + Intronic
1156079855 18:33319434-33319456 TCCATCATTGATGGACATTTGGG + Intronic
1156166224 18:34424353-34424375 TCTATCATTGATGGATATTTGGG + Intergenic
1156741270 18:40331891-40331913 TCTATCATTGATGGATATTTGGG + Intergenic
1157039411 18:44021082-44021104 TTTATCATTGATGGACATTTGGG + Intergenic
1157649241 18:49311475-49311497 CCTATCATTGATGGACATTTAGG - Intronic
1158477771 18:57795454-57795476 TTCATCTGTGATAGATATTTGGG - Intronic
1159068932 18:63600879-63600901 TTTATCATTGATGGATATTTAGG + Intronic
1159077157 18:63693804-63693826 CCTATCATTGATGGGTATTTGGG - Intronic
1159305723 18:66639944-66639966 TCCATCACTGATGGACATTTGGG - Intergenic
1159310412 18:66700300-66700322 CTGATAAGAGAGGGATATTTGGG - Intergenic
1159313487 18:66739858-66739880 TCTATCATTGATGGATATTTGGG - Intergenic
1159460141 18:68714002-68714024 TGCATCAGTGATGAATTTTTTGG - Intronic
1159862534 18:73665723-73665745 TCCATCACTGATGGACATTTGGG + Intergenic
1160260147 18:77285736-77285758 TCTATCAGTGATGGACATTTGGG + Intergenic
1160289983 18:77583469-77583491 TCTATCAGTGATGGACATTTGGG - Intergenic
1160661815 19:304700-304722 CACATCAGTGAGGGAAATGTGGG - Intergenic
1164110601 19:22154107-22154129 TTTATCATTGATGGACATTTGGG - Intergenic
1164333189 19:24280882-24280904 TCTATCATTGATGGATATTTGGG - Intergenic
1164433045 19:28204777-28204799 TCTATCATTGATGGATATTTCGG + Intergenic
1164555803 19:29250032-29250054 TCCATCATTGATGGACATTTGGG + Intergenic
1164867336 19:31615595-31615617 TCTATCACTGATGGATATTTGGG - Intergenic
1165011949 19:32855046-32855068 TTCATCTGTGATGGACACTTAGG - Intronic
1166353968 19:42216472-42216494 CACATCAGTGATGATGATTTTGG - Intronic
1167071492 19:47224652-47224674 TTTCTCATTGATGGATATTTAGG - Intronic
925052055 2:823252-823274 TTGTTCACTGATGGATATTTGGG - Intergenic
925322238 2:2981913-2981935 CCTATCATTGATGGACATTTGGG + Intergenic
925432746 2:3809986-3810008 CTTATCATTGATGGGCATTTGGG + Intronic
925630747 2:5890517-5890539 TCTATCATTGATGGATATTTGGG + Intergenic
925956679 2:8973117-8973139 TCTATCATTGATGGATATTTAGG - Intronic
926428425 2:12761479-12761501 GACATCAGTGATGGTGATTTTGG + Intergenic
927015573 2:18956824-18956846 TCTATCATTGATGGATATTTGGG - Intergenic
927602597 2:24457135-24457157 ATCATCAGTGATGCATCTTGGGG + Intergenic
928034835 2:27812457-27812479 TTTATCATTGATGGACATTTGGG - Intronic
928343455 2:30467332-30467354 TTTATCATTGATGGACATTTGGG + Intronic
928366073 2:30704373-30704395 CTGCCCATTGATGGATATTTAGG + Intergenic
928470626 2:31572077-31572099 TCCACCATTGATGGATATTTAGG - Intronic
928720386 2:34114246-34114268 TTTATCATTGATGGACATTTGGG + Intergenic
928806984 2:35170752-35170774 AGTATCAGTGATAGATATTTTGG - Intergenic
928810998 2:35225987-35226009 TCTATCAGTGATGGACATTTAGG - Intergenic
929196996 2:39195200-39195222 CTCATCCTTGATGGACATTTGGG + Intronic
929263967 2:39897964-39897986 CTCATCTTGGATGAATATTTGGG + Intergenic
929662654 2:43804234-43804256 TTCACCACTGATGAATATTTTGG + Intronic
930023159 2:47013495-47013517 CCCCTCAGAGATGGGTATTTTGG - Intronic
930451710 2:51547524-51547546 CTGATAGGAGATGGATATTTTGG - Intergenic
930452735 2:51562531-51562553 TTCATCATTGATGGATACTTAGG + Intergenic
930528928 2:52567226-52567248 CTTATCATTGATGGGCATTTAGG + Intergenic
930563775 2:52994447-52994469 CCCGTCATTGATGGACATTTAGG - Intergenic
930622329 2:53657381-53657403 GTCATCATTGATGGGCATTTAGG - Intronic
930839690 2:55831922-55831944 TCCATCATTGATGGACATTTGGG + Intergenic
930995575 2:57713314-57713336 GTCATCACTAAAGGATATTTAGG - Intergenic
931097130 2:58953798-58953820 CTCCTCAGTGATGGTTATCTGGG + Intergenic
931552484 2:63462098-63462120 CCTATCATTGATGGACATTTGGG - Intronic
931929981 2:67121084-67121106 TCTATCATTGATGGATATTTGGG + Intergenic
932015062 2:68017572-68017594 TCTATCATTGATGGATATTTGGG - Intergenic
932088456 2:68783311-68783333 CATATCAGTGTTTGATATTTGGG + Intronic
932104488 2:68930461-68930483 TCTATCATTGATGGATATTTGGG - Intergenic
932223469 2:70020338-70020360 TTCATCACTGATAGACATTTGGG - Intergenic
932494987 2:72141807-72141829 ATCATCAGTTAGGGAGATTTGGG + Intronic
932506944 2:72243341-72243363 TCTATCATTGATGGATATTTGGG - Intronic
933467723 2:82676839-82676861 TCTATCATTGATGGATATTTGGG - Intergenic
933850060 2:86358825-86358847 TCTATCATTGATGGATATTTGGG + Intergenic
933880938 2:86669436-86669458 CCTATCATTGATGGACATTTGGG - Intronic
934316820 2:91929294-91929316 TTCACCATTGATGGACATTTAGG - Intergenic
934983131 2:98864155-98864177 CTATCCAGAGATGGATATTTGGG - Intronic
935265539 2:101390429-101390451 TTCATCATTGATGGACATTTAGG + Intergenic
935961052 2:108425946-108425968 CTTATCATTGATGGGCATTTGGG - Intergenic
936658823 2:114519365-114519387 TTTATCAGTGTTGGTTATTTGGG + Intronic
937225195 2:120364777-120364799 CTCCTTATTGTTGGATATTTAGG + Intergenic
937485450 2:122310474-122310496 CTCATAAAGGATGGATATGTGGG + Intergenic
937485940 2:122314852-122314874 CTCATAAAGGATGGATATGTGGG - Intergenic
937575592 2:123417632-123417654 TCTATCATTGATGGATATTTGGG + Intergenic
937636612 2:124163228-124163250 CCCATCAGTGTTTGATATTTGGG + Intronic
938684810 2:133727974-133727996 CCTATCATTGATGGACATTTGGG + Intergenic
938997923 2:136700500-136700522 TCTATCATTGATGGATATTTGGG - Intergenic
939105482 2:137943833-137943855 CTCATTGGTGATGGTCATTTGGG + Intergenic
939192887 2:138937297-138937319 TTTATCATTGATAGATATTTGGG + Intergenic
939594996 2:144111922-144111944 CTCCTTAGTGATGAATATTTGGG - Intronic
940411261 2:153365989-153366011 CCTATCACTGATGGACATTTGGG - Intergenic
940413187 2:153390059-153390081 TCTATCATTGATGGATATTTGGG - Intergenic
940457856 2:153923933-153923955 CCTATCATTGATGGACATTTGGG + Intronic
940463204 2:153994309-153994331 CCTATCATTGATGGACATTTGGG + Intronic
940965040 2:159827705-159827727 TTTATCATTGATGGACATTTGGG - Intronic
941082850 2:161081758-161081780 CCCATCATTAATGGACATTTGGG + Intergenic
941483542 2:166048596-166048618 CCTATCATTGATGGACATTTAGG + Intronic
941773750 2:169369619-169369641 TTTATCATTGATGGACATTTGGG - Intergenic
941845827 2:170131657-170131679 TTTATCATTGATGGACATTTGGG - Intergenic
942151627 2:173081722-173081744 CACATCAGTGATGGAAATAAAGG - Intronic
942523546 2:176829548-176829570 CTCATTAGTAATGCAAATTTTGG + Intergenic
942804094 2:179909513-179909535 TTCACCACTGATGGACATTTGGG - Intergenic
942885134 2:180913955-180913977 TTTATCATTGATGGACATTTAGG + Intergenic
943126322 2:183797137-183797159 TTTATCATTGATGGACATTTGGG - Intergenic
943552885 2:189362829-189362851 CTCATCAGTATTAGACATTTTGG - Intergenic
943850270 2:192711619-192711641 GCCATCAGTGAAGGATATTTTGG - Intergenic
943908354 2:193529846-193529868 TCTATCATTGATGGATATTTGGG + Intergenic
943929459 2:193831262-193831284 TTTATCATTGATGGACATTTGGG + Intergenic
944126008 2:196293395-196293417 TCTATCATTGATGGATATTTGGG + Intronic
944192771 2:197021190-197021212 CCTATCATTGATGGACATTTGGG + Intronic
944271591 2:197789567-197789589 TCCATCATTGATGGACATTTGGG + Intergenic
944286529 2:197956213-197956235 TTTATCATTGATGAATATTTGGG + Intronic
944308219 2:198202008-198202030 CCTATCACTGATGGACATTTAGG - Intronic
944476702 2:200113681-200113703 TCCATCATTGATGGACATTTAGG + Intergenic
945107746 2:206331897-206331919 TCCATCAGTGATGGACTTTTGGG + Intergenic
945349972 2:208765880-208765902 CCCATCATTGATGGACATTTGGG - Intronic
945596938 2:211807536-211807558 TCTATCATTGATGGATATTTGGG + Intronic
945722459 2:213435057-213435079 TTCATCACTGATGGACACTTAGG - Intronic
945927935 2:215825059-215825081 TTCATCATTGATGAACATTTGGG - Intergenic
946080153 2:217111557-217111579 GTAAACAGTGAGGGATATTTGGG - Intergenic
946210095 2:218140644-218140666 TTCCCCACTGATGGATATTTAGG - Intergenic
946597952 2:221327270-221327292 CCTATCATTGATGGAAATTTGGG - Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
947394171 2:229671214-229671236 CTGATGAGTGATGGCTGTTTGGG - Intronic
947828623 2:233123715-233123737 GTCATCACTGATGGGCATTTAGG - Intronic
949038206 2:241829490-241829512 TCTATCAGTGATGGACATTTGGG - Intergenic
1169220142 20:3817741-3817763 TCCATAACTGATGGATATTTGGG + Intergenic
1169710560 20:8557293-8557315 TTCTCCACTGATGGATATTTGGG - Intronic
1170520280 20:17178134-17178156 CTCTCCATTGATGGGTATTTGGG + Intergenic
1170984926 20:21248796-21248818 TTTATAAGTGATGGACATTTGGG - Intergenic
1172447496 20:35000874-35000896 CACATCAGTGATGGCCTTTTTGG - Exonic
1172655972 20:36538659-36538681 CTCATCATGGATGGACACTTGGG - Intergenic
1172965367 20:38830380-38830402 CTTATAAGTGACTGATATTTGGG - Intronic
1174662424 20:52225403-52225425 CTCAGCAGTGATGTACATTACGG + Intergenic
1174921856 20:54711784-54711806 CTCATCTGTGATCAACATTTTGG - Intergenic
1174981640 20:55402050-55402072 TTCATCTGTGATGGATACTTAGG + Intergenic
1175180040 20:57139697-57139719 CTCATTAGTTATGGATGTTTGGG + Intergenic
1177024974 21:15911635-15911657 CCTATCATTGATGGATATTTGGG + Intergenic
1177122679 21:17157493-17157515 TCTATCATTGATGGATATTTGGG - Intergenic
1177267802 21:18807073-18807095 CTCATGAGTGATGGAGATAAAGG - Intergenic
1177706702 21:24715166-24715188 CACATCAGGGATGGCTATTGAGG - Intergenic
1178236931 21:30853957-30853979 TCCATCATTGATGGACATTTGGG - Intergenic
1178746207 21:35252599-35252621 TTCATCAGTAATGAATATGTAGG - Intronic
1180394586 22:12319141-12319163 CTTATCATTGTTGGACATTTGGG + Intergenic
1180405160 22:12545607-12545629 CTTATCATTGTTGGACATTTGGG - Intergenic
1180860340 22:19075822-19075844 TTCATCTGTGATGGACACTTGGG + Intronic
1180924132 22:19541600-19541622 CTATTCACTGATGGATATTTGGG - Intergenic
1181326351 22:22051356-22051378 TCTATCAGTGATGGACATTTGGG + Intergenic
1182070267 22:27458591-27458613 CCCATCACTGATGGTTATCTTGG - Intergenic
1182163612 22:28149352-28149374 CTCATCCATGATGGACACTTAGG - Intronic
1182410235 22:30179140-30179162 CCCAACAGTATTGGATATTTAGG + Intergenic
1183758454 22:39792826-39792848 GTCATCTGTGATGGACAATTAGG + Intronic
1184054581 22:42036055-42036077 TTCATCACTGAAGGACATTTAGG + Intronic
1185036611 22:48481383-48481405 CTTACCTGTGATGGACATTTGGG - Intergenic
949145489 3:694482-694504 CTCATCGTTGATGGGCATTTAGG + Intergenic
949393773 3:3592820-3592842 TCCATCATTGATGGATGTTTAGG - Intergenic
949458511 3:4264825-4264847 CTCATCAGTTAAGAACATTTTGG + Intronic
949471482 3:4401207-4401229 TTTATCACTGATGGACATTTGGG + Intronic
949565929 3:5244874-5244896 TCTATCATTGATGGATATTTGGG - Intergenic
949682826 3:6535268-6535290 TCTATCATTGATGGATATTTGGG + Intergenic
950290953 3:11784075-11784097 CTCTTCAGTAGTGGAGATTTGGG + Intergenic
951012898 3:17701078-17701100 TCCATCATTGATGGACATTTGGG - Intronic
951023370 3:17804718-17804740 TTAATCAGTGATGGACATTTGGG + Intronic
951094577 3:18613777-18613799 CTCATGATTGATGGGCATTTGGG - Intergenic
951286107 3:20815817-20815839 TCTATCATTGATGGATATTTGGG + Intergenic
951386317 3:22047640-22047662 TTCATCATTGGTGGATATGTAGG + Intronic
951963624 3:28356602-28356624 TTTATCACTGATGGACATTTGGG - Intronic
952631732 3:35477762-35477784 TCTATCATTGATGGATATTTGGG + Intergenic
952914271 3:38220893-38220915 CTCATCAGTGACTGGTACTTTGG + Intronic
953098611 3:39804088-39804110 TCCATCACTGATGGACATTTAGG - Intergenic
953163194 3:40441344-40441366 TCCATCATTGATGGACATTTGGG - Intergenic
953756481 3:45650729-45650751 CCTATTATTGATGGATATTTGGG + Intronic
954191007 3:48960857-48960879 CTCATTTTTGTTGGATATTTAGG + Intronic
954526508 3:51276517-51276539 CTTACCAGTGATGTATCTTTGGG - Intronic
954563022 3:51574238-51574260 CCTATCACTGATGGACATTTGGG + Intronic
955483807 3:59415783-59415805 TCTATCATTGATGGATATTTGGG - Intergenic
955822240 3:62908531-62908553 TCCATCATTGATGGACATTTGGG - Intergenic
955994394 3:64664667-64664689 TTCATCATTGGTGGACATTTGGG + Intronic
956464405 3:69504702-69504724 TTCATCAGTAATGGATATTTGGG + Intronic
956569294 3:70676060-70676082 TCTATCATTGATGGATATTTGGG + Intergenic
956781795 3:72609273-72609295 TCTATCACTGATGGATATTTGGG - Intergenic
956806902 3:72823529-72823551 TTCATGATTGATGGATATTTGGG - Intronic
956854907 3:73266707-73266729 TCCATCACTGATGGACATTTAGG - Intergenic
956861949 3:73333239-73333261 TCTATCATTGATGGATATTTGGG + Intergenic
956913908 3:73850709-73850731 TACATCATTGATGGACATTTAGG + Intergenic
956985186 3:74690529-74690551 CCTATCATTGATGGACATTTGGG - Intergenic
957354381 3:79062596-79062618 TCCATCATTGATGGACATTTGGG - Intronic
957671288 3:83305760-83305782 TTTATCATTGATGGACATTTGGG + Intergenic
957723727 3:84037383-84037405 TTTATCATTGATGGACATTTAGG - Intergenic
958492515 3:94795571-94795593 TCTATCATTGATGGATATTTGGG - Intergenic
958496612 3:94851623-94851645 CTTATCATTGTTGGACATTTGGG - Intergenic
958708659 3:97690025-97690047 TTCATCAGTGATGAACATTTGGG + Intronic
958751722 3:98200064-98200086 TTTATCATTGATGGACATTTGGG - Intergenic
958975886 3:100667569-100667591 TTTATCATTGATGGACATTTGGG + Intronic
959778689 3:110202032-110202054 TCTATCATTGATGGATATTTGGG + Intergenic
960230110 3:115216131-115216153 TCCATCATTGATGGACATTTGGG + Intergenic
961395593 3:126586394-126586416 TCTATCATTGATGGATATTTGGG + Intronic
961860713 3:129915098-129915120 CTCATCATTGTTGGAGATTTAGG - Intergenic
962079418 3:132121251-132121273 TTTATCATTGATGGGTATTTGGG + Intronic
962339117 3:134567012-134567034 TTCATCAATGATGGATATTTAGG - Intronic
963053831 3:141166481-141166503 CTCACCATTGATGGGCATTTGGG + Intergenic
963060985 3:141226392-141226414 TTCACCATTGATGGACATTTGGG - Intergenic
963109582 3:141675927-141675949 TCTATCATTGATGGATATTTGGG - Intergenic
963527711 3:146435164-146435186 TCTATCATTGATGGATATTTGGG + Intronic
964696854 3:159517985-159518007 TTCCATAGTGATGGATATTTAGG - Intronic
964699343 3:159546814-159546836 TCTATCATTGATGGATATTTGGG + Intronic
965372514 3:167881295-167881317 CTCAGGAGTGATGGAGAGTTCGG + Intergenic
965739488 3:171858898-171858920 TCTATCATTGATGGATATTTGGG - Exonic
966073621 3:175908764-175908786 CCTATCATTGATGGACATTTGGG - Intergenic
966178243 3:177163137-177163159 CCCTTCATTGATGGATATTCAGG - Intronic
966456369 3:180120581-180120603 TCTATCATTGATGGATATTTGGG + Intergenic
966536543 3:181041288-181041310 CCTATCATTGATGGACATTTGGG + Intergenic
966991021 3:185230416-185230438 CTAATCATTGATGGACATTTGGG - Intronic
969160010 4:5248674-5248696 TCCATCACTGATGGACATTTGGG - Intronic
969611685 4:8231195-8231217 ATCAACAGTGAAGGAAATTTGGG - Intronic
969728033 4:8937013-8937035 TTCATCATTGATGGACACTTGGG - Intergenic
969889569 4:10247212-10247234 CCTATCATTGATGGACATTTGGG + Intergenic
970208093 4:13676707-13676729 ATCCTCATTGATGGAAATTTAGG + Intergenic
970288705 4:14548695-14548717 CCTATCATTGATGGGTATTTGGG - Intergenic
970405624 4:15760322-15760344 TTCATCAATTAAGGATATTTGGG + Intergenic
970782872 4:19759849-19759871 CCTATCATTGATGGACATTTGGG - Intergenic
971331598 4:25685982-25686004 CCCCGCAGTGGTGGATATTTGGG - Intergenic
972159611 4:36207133-36207155 CTCTTCTGAGATGCATATTTGGG + Intronic
972225118 4:37003544-37003566 TTCATCATTGATGGACATTTAGG + Intergenic
972710463 4:41589836-41589858 CTCATCAGGGACTTATATTTGGG - Intronic
972905810 4:43745719-43745741 TCTATCATTGATGGATATTTGGG - Intergenic
973025644 4:45266666-45266688 CCTATCATTGATGGACATTTGGG - Intergenic
973599505 4:52527940-52527962 TTTATCATTGATGGACATTTGGG - Intergenic
973778936 4:54270245-54270267 CACCTAAATGATGGATATTTAGG + Intronic
973801717 4:54484898-54484920 CTCTTCATTGATGGTCATTTGGG - Intergenic
973867658 4:55129993-55130015 TCTATCATTGATGGATATTTGGG - Intergenic
973884060 4:55302874-55302896 TTTATCATTGATGGACATTTGGG - Intergenic
974119314 4:57619726-57619748 TCTATCATTGATGGATATTTGGG + Intergenic
974491110 4:62566209-62566231 CCTATCATTGACGGATATTTGGG + Intergenic
974567407 4:63595344-63595366 GTCATCATTGATGGACATTTGGG - Intergenic
974654822 4:64805215-64805237 TCTATCATTGATGGATATTTGGG - Intergenic
974706308 4:65521123-65521145 CCTATCATTGATGGACATTTGGG - Intronic
974961468 4:68706417-68706439 TTTATGACTGATGGATATTTGGG + Intergenic
974972709 4:68849280-68849302 CCTATCATTGATGGAAATTTGGG - Intergenic
975018303 4:69453225-69453247 CCTATCATTGATGGAAATTTGGG - Intergenic
975088601 4:70373500-70373522 CTCATGATTGATGGACATTTGGG + Intronic
976024442 4:80670381-80670403 CCTATCATTGATGGACATTTGGG + Intronic
976083937 4:81388198-81388220 TCCATCATTGATGGACATTTGGG - Intergenic
976207030 4:82632429-82632451 TCTATCATTGATGGATATTTGGG + Intronic
976333762 4:83862221-83862243 TCTATCATTGATGGATATTTGGG + Intergenic
977239961 4:94556298-94556320 CCTATCATTGATGGACATTTGGG + Intronic
977387655 4:96363862-96363884 TTTATCAGTGATGGAGATCTGGG - Intergenic
977508506 4:97932759-97932781 TCCATCATTGATGGTTATTTGGG + Intronic
977585023 4:98765293-98765315 TTTATCAGTGATGGACACTTAGG + Intergenic
977625208 4:99182317-99182339 CCTATCATTGATGGACATTTGGG + Intergenic
977857263 4:101909140-101909162 CCTATCATTGATGGACATTTGGG - Intronic
977871773 4:102099082-102099104 TTCATCGGTGATGAACATTTGGG - Intergenic
977906718 4:102485337-102485359 TCTATCATTGATGGATATTTGGG - Intergenic
977914134 4:102572082-102572104 TTTATCACTGATGGACATTTGGG - Intronic
977947225 4:102927823-102927845 TCCATCATTGATGGACATTTGGG - Intronic
978019753 4:103793000-103793022 TCCATCATTGATGGACATTTGGG - Intergenic
978075746 4:104527414-104527436 TTCATCATTGATGGGCATTTAGG + Intergenic
978188495 4:105885782-105885804 TCTATCATTGATGGATATTTGGG - Intronic
978204796 4:106068541-106068563 TCTATCATTGATGGATATTTGGG + Intronic
978438253 4:108708736-108708758 TCTATCATTGATGGATATTTGGG - Intergenic
978459381 4:108934082-108934104 TCTATCATTGATGGATATTTGGG - Intronic
978471342 4:109070928-109070950 CCTATCATTGATGGACATTTGGG + Intronic
978658452 4:111095036-111095058 GTCATCATTGTTGGACATTTGGG + Intergenic
978914439 4:114106494-114106516 CTCATTTGTGATAGGTATTTGGG - Intergenic
979433676 4:120663114-120663136 CCTATCATTGATGGACATTTAGG + Intergenic
979487977 4:121290517-121290539 CCTATCATTGATGGACATTTGGG - Intergenic
979517084 4:121621962-121621984 TCTATCATTGATGGATATTTGGG - Intergenic
979572314 4:122242221-122242243 CTATTCATTGATGGACATTTAGG - Intronic
979584416 4:122398371-122398393 CTCATGATTGATGGGCATTTGGG + Intronic
979750181 4:124269763-124269785 TCTATCATTGATGGATATTTGGG + Intergenic
979854642 4:125616536-125616558 TTCGTCACTGATGGACATTTAGG + Intergenic
980147234 4:129003032-129003054 TTTATCATTGATGGACATTTGGG - Intronic
980545088 4:134250304-134250326 TTCATCAGTGTTGGATACTTAGG + Intergenic
981010988 4:139924913-139924935 ATCATCAGTAATGCAGATTTGGG - Intronic
981127561 4:141123944-141123966 TCTATCATTGATGGATATTTGGG + Intronic
981353338 4:143757758-143757780 TCTATCACTGATGGATATTTGGG - Intergenic
981611127 4:146595030-146595052 TCCATCATTGATGGACATTTGGG - Intergenic
981682347 4:147414036-147414058 TCTATCATTGATGGATATTTAGG + Intergenic
982603595 4:157484722-157484744 TTTATCACTGATGGACATTTGGG + Intergenic
982624969 4:157755218-157755240 TCTATCATTGATGGATATTTGGG + Intergenic
983673335 4:170263671-170263693 TCTATCACTGATGGATATTTGGG + Intergenic
983932216 4:173464838-173464860 TTCATCCATGATGGACATTTGGG - Intergenic
983948335 4:173610798-173610820 TCCATCATTGATGGACATTTGGG + Intergenic
984325366 4:178243285-178243307 CATATCATTGATGGACATTTAGG + Intergenic
986085336 5:4439027-4439049 CTCATCAGTAATTGGTGTTTTGG - Intergenic
987149563 5:15024837-15024859 CCTATCATTGATGGACATTTGGG + Intergenic
987259524 5:16189395-16189417 TCTATCACTGATGGATATTTGGG - Intergenic
988005821 5:25408608-25408630 TCTATCAGTGATGGACATTTGGG + Intergenic
988010528 5:25476263-25476285 CCTATCATTGATGGACATTTGGG - Intergenic
988023197 5:25650583-25650605 TCTATCATTGATGGATATTTGGG + Intergenic
988172003 5:27669962-27669984 TCTATCATTGATGGATATTTGGG + Intergenic
988192551 5:27957987-27958009 CCTATCACTGATGGGTATTTAGG + Intergenic
988209508 5:28184920-28184942 GTCATCATTGATGGACATTTGGG + Intergenic
988253890 5:28798628-28798650 TCGATCAGTGATGGACATTTGGG - Intergenic
988420962 5:31005643-31005665 GTTATCAGTGATGGGCATTTGGG + Intergenic
988422387 5:31022319-31022341 TTTATCAGTGATGGGCATTTGGG + Intergenic
988840669 5:35080789-35080811 TCCATCATTGATGGACATTTGGG - Intronic
989006031 5:36813392-36813414 CTTATCATTGTTGGACATTTGGG - Intergenic
989513329 5:42313862-42313884 TCCATCATTGATGGACATTTAGG + Intergenic
989769147 5:45121617-45121639 TCCATCATTGATGGACATTTGGG - Intergenic
990065033 5:51701827-51701849 TTTATCATTGATGGACATTTGGG - Intergenic
990679233 5:58222454-58222476 TATATCATTGATGGATATTTGGG - Intergenic
990870488 5:60426278-60426300 CCTATCAATGATGGACATTTGGG - Intronic
990912436 5:60866027-60866049 TCTATCATTGATGGATATTTGGG - Intergenic
990929154 5:61067552-61067574 TCTATCATTGATGGATATTTGGG + Intronic
991529423 5:67598727-67598749 TCTATCATTGATGGATATTTGGG + Intergenic
991532150 5:67627348-67627370 TTTATCATTGATGGACATTTGGG + Intergenic
991545719 5:67779968-67779990 TCCATCATTGATGGACATTTGGG - Intergenic
991635664 5:68702294-68702316 TCTATCATTGATGGATATTTGGG + Intergenic
992365937 5:76089421-76089443 CTTATCATTGATGGGCATTTAGG + Intronic
992619631 5:78579736-78579758 CTTATCATTGTTGGACATTTGGG + Intronic
992756985 5:79916696-79916718 TCTATCATTGATGGATATTTGGG - Intergenic
992937261 5:81720716-81720738 GTCATCAGTTATGCATTTTTAGG + Intronic
992970592 5:82052877-82052899 ATCTTCACTGATGGAAATTTAGG + Intronic
993006871 5:82437823-82437845 TCTATCATTGATGGATATTTAGG + Intergenic
993214061 5:84996752-84996774 CTTATTGGTGATGGATATTTGGG + Intergenic
993286905 5:86011012-86011034 TTCACCAGTGATAGTTATTTAGG + Intergenic
993437805 5:87919380-87919402 TCTATCATTGATGGATATTTGGG + Intergenic
993878718 5:93338894-93338916 TCCATCATTGATGGATACTTGGG + Intergenic
994418448 5:99503364-99503386 TCTATCATTGATGGATATTTCGG - Intergenic
994637043 5:102356588-102356610 TATATCAGTGATGGACATTTGGG - Intergenic
994861018 5:105194315-105194337 TCTATCACTGATGGATATTTGGG + Intergenic
995157511 5:108932414-108932436 CCTATCACTGATGGACATTTGGG + Intronic
995422071 5:111978929-111978951 TCCATCACTGATGGACATTTGGG - Intronic
995671099 5:114603916-114603938 TCCATCACTGATGGACATTTGGG - Intergenic
995855699 5:116589961-116589983 TCTATCACTGATGGATATTTGGG - Intergenic
996521290 5:124428883-124428905 TTTATCATTGATGGACATTTGGG - Intergenic
996871713 5:128199841-128199863 CTCATCAGTGATGAATAAGTGGG - Intergenic
996894345 5:128461598-128461620 CTTATCATTGATGGCCATTTGGG - Intronic
996959827 5:129233935-129233957 CCCATCATTGATGGATATTTGGG + Intergenic
997066626 5:130567611-130567633 TTAATCATTGATGGACATTTGGG - Intergenic
997075260 5:130667160-130667182 CCTATCACTGATGGACATTTAGG - Intergenic
997291533 5:132739482-132739504 TTTGTCATTGATGGATATTTGGG + Intergenic
999518087 5:152321098-152321120 TCTATCATTGATGGATATTTGGG - Intergenic
999541535 5:152579507-152579529 TTCACCATTGATGGACATTTAGG + Intergenic
999558843 5:152776591-152776613 TCCATCACTGATGGACATTTGGG - Intergenic
999665890 5:153912491-153912513 GTTATCACTGATGGGTATTTAGG + Intergenic
1000048121 5:157538413-157538435 CTCTTCCCTGATGCATATTTTGG + Intronic
1000053707 5:157584567-157584589 GTCACCCGTGAAGGATATTTGGG + Intergenic
1000284233 5:159812874-159812896 TACATCATTGATGGACATTTGGG - Intergenic
1000510099 5:162170463-162170485 CCCATCACTGATGGGCATTTAGG - Intergenic
1000562310 5:162805134-162805156 CTTATCAGAGATGCTTATTTTGG + Intergenic
1000710296 5:164566770-164566792 GTTATCAGGGAAGGATATTTTGG - Intergenic
1000720351 5:164698500-164698522 TCTATCATTGATGGATATTTGGG - Intergenic
1000816611 5:165930483-165930505 GTTATCATTGATGGACATTTGGG - Intergenic
1001149204 5:169212014-169212036 TGTATCATTGATGGATATTTGGG + Intronic
1002011603 5:176287227-176287249 TGTATCATTGATGGATATTTGGG - Intronic
1002514522 5:179747440-179747462 TTCATCTGTGATGGACATTCAGG - Intronic
1003782927 6:9449467-9449489 TCCATCATTGATGGACATTTGGG - Intergenic
1003793336 6:9572523-9572545 TTTATCATTGATGGACATTTGGG - Intergenic
1003971515 6:11304554-11304576 TCTATCATTGATGGATATTTGGG - Intronic
1004030577 6:11864768-11864790 TCCATCATTGATGGACATTTGGG - Intergenic
1004181355 6:13383062-13383084 TTTATCACTGATGGGTATTTGGG + Intronic
1004239011 6:13901956-13901978 CTCATGAGGGCTGCATATTTTGG + Intergenic
1004550028 6:16637826-16637848 CTCATCAGTTTGGGAAATTTAGG + Intronic
1004937812 6:20525306-20525328 CCTATCATTGATGGACATTTGGG - Intergenic
1005116384 6:22342570-22342592 CCTATCACTGATGGACATTTAGG + Intergenic
1005747709 6:28854513-28854535 TCTATCATTGATGGATATTTGGG - Intergenic
1006240227 6:32671612-32671634 CCTATCACTGATGGACATTTGGG + Intergenic
1008204592 6:48639269-48639291 CCTATCAGTCATGGACATTTAGG - Intergenic
1008225208 6:48906311-48906333 CCCATCATTGATGGGCATTTGGG + Intergenic
1008287611 6:49673070-49673092 TCTATCAGTGATGGACATTTGGG - Intergenic
1008342356 6:50382796-50382818 TTAATCATTGATGGACATTTGGG + Intergenic
1008407116 6:51130749-51130771 TCTATCATTGATGGATATTTGGG + Intergenic
1008750566 6:54728915-54728937 TCCATCATTGATGGACATTTGGG - Intergenic
1008794891 6:55291308-55291330 TCTATCATTGATGGATATTTGGG - Intergenic
1009212870 6:60883983-60884005 TCTATCATTGATGGATATTTGGG + Intergenic
1009649008 6:66449105-66449127 CCTATCATTGATGGACATTTGGG - Intergenic
1009686139 6:66960214-66960236 TCTATCATTGATGGATATTTGGG - Intergenic
1010501300 6:76603831-76603853 CCTATCATTGATGGGTATTTGGG - Intergenic
1010537896 6:77053620-77053642 TTTATCATTGATGGACATTTGGG - Intergenic
1010654660 6:78497795-78497817 CTCACCAGTGATGCACATCTAGG + Intergenic
1010972574 6:82278484-82278506 CCTATCATTGATGGACATTTGGG + Intergenic
1011296293 6:85829768-85829790 TCTATCATTGATGGATATTTGGG + Intergenic
1011537265 6:88390037-88390059 TCTATCATTGATGGATATTTGGG - Intergenic
1011577219 6:88815751-88815773 CTCATCTGTGATGGCTAACTGGG - Intronic
1011871764 6:91903391-91903413 TTTATCACTGATGGACATTTAGG + Intergenic
1012406518 6:98906564-98906586 TCTATCACTGATGGATATTTGGG + Intronic
1012726922 6:102825154-102825176 TTTATCACTGATGGACATTTGGG + Intergenic
1013223677 6:108103506-108103528 CACATAAGTGATTGATATATGGG + Intronic
1013310724 6:108891144-108891166 CCTATCATTGATGGACATTTGGG + Intronic
1013518323 6:110910026-110910048 CCTATCATTGATGGATATTTGGG - Intergenic
1013609745 6:111783330-111783352 CTCATCAGTCATGGTTATTGGGG - Intronic
1013682143 6:112536121-112536143 CCCATTATTGATGGACATTTAGG + Intergenic
1013683448 6:112551004-112551026 TTTATCACTGATGGACATTTGGG + Intergenic
1013882602 6:114923575-114923597 TCTATCACTGATGGATATTTGGG + Intergenic
1014179539 6:118370165-118370187 TCCACCATTGATGGATATTTAGG - Intergenic
1014409573 6:121097791-121097813 ATTATCATTGATGGAAATTTGGG - Intronic
1014410004 6:121103332-121103354 TCTATCATTGATGGATATTTGGG - Intronic
1014496517 6:122130533-122130555 TTCAACAGTGTTGGAAATTTGGG - Intergenic
1014956126 6:127618580-127618602 CTCATCTTTCATGGATTTTTAGG + Intergenic
1014959668 6:127667819-127667841 TTTATCATTGATGGACATTTGGG + Intergenic
1015725560 6:136295987-136296009 TTCATCACTGATGGACATTTAGG + Intergenic
1015821237 6:137262891-137262913 TTCATCCATGATGAATATTTAGG - Intergenic
1016005497 6:139084815-139084837 TCCATCACTGATGGACATTTGGG + Intergenic
1016033741 6:139363904-139363926 TCCATCATTGATGGACATTTGGG - Intergenic
1016294478 6:142560098-142560120 TCTATCACTGATGGATATTTGGG + Intergenic
1016781618 6:147965535-147965557 TCTATCATTGATGGATATTTGGG - Intergenic
1016875324 6:148858891-148858913 CCTATCATTGATGGACATTTGGG + Intronic
1017821607 6:158053215-158053237 CTCATTAGTGATGTTAATTTTGG + Intronic
1017832236 6:158141040-158141062 TTCATCAGTGATGGACATTTGGG - Intronic
1018229776 6:161664175-161664197 CTCCTCACAGCTGGATATTTGGG - Intronic
1018283179 6:162209705-162209727 TCTATCATTGATGGATATTTGGG - Intronic
1018435713 6:163756871-163756893 CTCATCAGTGATGGACACTTGGG + Intergenic
1018527955 6:164734952-164734974 CCTATCATTGATGGACATTTGGG + Intergenic
1018539920 6:164867991-164868013 TCTATCACTGATGGATATTTGGG + Intergenic
1019006440 6:168801007-168801029 TTCATCTGTGATGGACACTTAGG + Intergenic
1019484014 7:1280020-1280042 TCCATCATTGATGGATATTTGGG - Intergenic
1019826388 7:3287845-3287867 TCTATCACTGATGGATATTTGGG + Intergenic
1020338482 7:7083832-7083854 TCCATCATTGATGGGTATTTGGG + Intergenic
1020525764 7:9256593-9256615 TTTATCATTGATGGATATTTGGG - Intergenic
1020683375 7:11264212-11264234 TCCATCATTGATGGGTATTTGGG - Intergenic
1020873767 7:13668464-13668486 TCTATCACTGATGGATATTTGGG + Intergenic
1021127947 7:16875503-16875525 TTCATCAGTTAATGATATTTGGG + Intronic
1021183760 7:17538785-17538807 CTCATCGTTGATGGGCATTTGGG - Intergenic
1021321580 7:19219197-19219219 TCTATCATTGATGGATATTTGGG - Intergenic
1022058215 7:26763439-26763461 ATCATCAGGGATGGATAGATTGG - Intronic
1022511800 7:30939783-30939805 TTCATGAGTGATGAACATTTGGG + Intronic
1022780509 7:33577650-33577672 TCTATCACTGATGGATATTTGGG - Intronic
1022998504 7:35783720-35783742 CTTATCATTGATGGACATTTGGG - Intergenic
1023333434 7:39143578-39143600 CTGACCAGAGATGGACATTTGGG + Intronic
1023409183 7:39871760-39871782 TTCATCAGTTATGGACCTTTGGG + Intergenic
1025136671 7:56420790-56420812 TTCATCAGTTATGGACCTTTGGG - Intergenic
1026125995 7:67580020-67580042 CCGATCAGTGCAGGATATTTTGG + Intergenic
1026255793 7:68710037-68710059 TTTATCACTGATGGGTATTTGGG - Intergenic
1026566910 7:71496740-71496762 ATTTTCAGTGATTGATATTTAGG - Intronic
1026971288 7:74469666-74469688 TTCATCAGTTATGGACATATGGG + Intronic
1027589826 7:80104457-80104479 CTCATCATTGATTGATAATTTGG + Intergenic
1027637615 7:80694723-80694745 TTTATCACTGATGGACATTTGGG - Intergenic
1027901503 7:84121603-84121625 TCTATCATTGATGGATATTTGGG + Intronic
1027923799 7:84433469-84433491 TTTATCATTGATGGACATTTGGG + Intronic
1028115097 7:86987945-86987967 TCTATCATTGATGGATATTTGGG - Intronic
1028436692 7:90812215-90812237 TTTATCATTGTTGGATATTTGGG - Intronic
1028998051 7:97123388-97123410 CCTATCGTTGATGGATATTTGGG + Intronic
1029061013 7:97797958-97797980 CTCAGCTGAGATGGATATCTGGG - Intergenic
1030236488 7:107268967-107268989 GTGATCAGTGATGTATATGTTGG + Intronic
1030708157 7:112716662-112716684 TCTATCATTGATGGATATTTGGG + Intergenic
1030749444 7:113212781-113212803 CCATTCATTGATGGATATTTGGG - Intergenic
1030813534 7:114005876-114005898 TTCATGCTTGATGGATATTTTGG - Intronic
1030889760 7:114985119-114985141 CTCACCAGTGATGTGTCTTTGGG + Intronic
1031157588 7:118127946-118127968 GCTATCAGTGATGGACATTTGGG - Intergenic
1031246579 7:119321011-119321033 CTCCTCAGAAATGAATATTTAGG - Intergenic
1031259661 7:119502536-119502558 TCTATCATTGATGGATATTTGGG + Intergenic
1031286938 7:119882414-119882436 TTTATCATTGATGGACATTTGGG - Intergenic
1031472760 7:122186896-122186918 TTCATCTGTGATGGACACTTAGG - Intergenic
1033673482 7:143514967-143514989 CTCATGAGGGAAGGATGTTTTGG - Intergenic
1034038586 7:147851520-147851542 TCTATCATTGATGGATATTTGGG - Intronic
1034132378 7:148731913-148731935 TTGATCAATGATGGACATTTGGG + Intronic
1035894327 8:3380487-3380509 CCTATCATTGATGGACATTTGGG - Intronic
1036055026 8:5242394-5242416 GTCACCATTGATGGACATTTAGG - Intergenic
1037092692 8:14942657-14942679 ATTTTCAGTGATGGAAATTTGGG - Intronic
1037115454 8:15220761-15220783 TTTATCACTGATGGACATTTGGG - Intronic
1037238616 8:16751701-16751723 TCTATCATTGATGGATATTTGGG + Intergenic
1038155572 8:24986252-24986274 CCATTCATTGATGGATATTTTGG + Intergenic
1038309135 8:26432119-26432141 TTCATCACTGATGGACACTTAGG + Intronic
1038833770 8:31094860-31094882 TTCATCAGTGATGGACATTTGGG + Intronic
1038922201 8:32097239-32097261 TTACTCATTGATGGATATTTAGG + Intronic
1039063223 8:33588833-33588855 TCCATCATTGATGGACATTTGGG + Intergenic
1040085769 8:43339233-43339255 TCTATCATTGATGGATATTTGGG - Intergenic
1040357067 8:46628984-46629006 CCCATCATTGATGGACATTCAGG - Intergenic
1040359089 8:46648018-46648040 CCTATCATTGATGGACATTTGGG - Intergenic
1040844803 8:51826112-51826134 CATATCATTGATGGACATTTTGG - Intronic
1040860414 8:51993318-51993340 CCTATCATTGATGGACATTTGGG - Intergenic
1040891216 8:52318644-52318666 CTTATCATTGATGGGCATTTAGG - Intronic
1041545755 8:59040647-59040669 CTCAGCAGTGCTGTATAATTGGG - Intronic
1041789869 8:61682958-61682980 TTTATCAGTGATGGACATTTGGG - Intronic
1042157282 8:65858204-65858226 TTTATCATTGATGGACATTTGGG - Intergenic
1042171237 8:65993245-65993267 CCTATCATTGATGGATATTTGGG + Intergenic
1042330512 8:67575481-67575503 TTCATCAGTGATGGACACTTAGG - Intronic
1042541634 8:69913281-69913303 TCTATCATTGATGGATATTTGGG - Intergenic
1043185434 8:77142441-77142463 CCCAACAGTGATTGATTTTTAGG + Intergenic
1043351978 8:79372737-79372759 CTTATCAGTGATGGGCATTTGGG - Intergenic
1043393298 8:79812045-79812067 CTTATCATTGATGGGCATTTGGG - Intergenic
1043499040 8:80834926-80834948 CCTATCATTGATGGACATTTGGG + Intronic
1043522077 8:81057318-81057340 TCTATCATTGATGGATATTTGGG - Intronic
1044402930 8:91793508-91793530 TTTATCACTGATGGACATTTGGG - Intergenic
1044440320 8:92216462-92216484 TTTATCATTGATGGACATTTGGG + Intergenic
1044596522 8:93964223-93964245 TCTATCATTGATGGATATTTGGG + Intergenic
1044632730 8:94295236-94295258 TCTATCATTGATGGATATTTGGG - Intergenic
1045163194 8:99572695-99572717 TCTATCATTGATGGATATTTGGG + Intronic
1045585272 8:103527783-103527805 TCTATCAGTGATGGACATTTGGG + Intronic
1045587325 8:103553194-103553216 GCTATCAGTGATGGATATTTGGG - Intronic
1045596706 8:103664874-103664896 TCTATCAGTGATGGACATTTGGG - Intronic
1045708767 8:104959077-104959099 TCTATCATTGATGGATATTTGGG + Intronic
1045729702 8:105222826-105222848 ATCATCAGTGATGCATATGAAGG - Intronic
1045798203 8:106070785-106070807 TCTATCAGTGATGGGTATTTGGG - Intergenic
1046027988 8:108747956-108747978 TTTATCATTGATGGGTATTTAGG + Intronic
1046174819 8:110561562-110561584 TCTATCATTGATGGATATTTGGG - Intergenic
1046188121 8:110749523-110749545 TTCATAAGTAATGGATATTTGGG - Intergenic
1046483505 8:114854320-114854342 TTTATCATTGATGGACATTTAGG - Intergenic
1046650760 8:116834505-116834527 CTCATCAGAAAAGGGTATTTTGG + Intronic
1046706375 8:117457018-117457040 CCTATCATTGATGGACATTTGGG - Intergenic
1046808809 8:118509785-118509807 ATAGTCAGTGTTGGATATTTAGG - Intronic
1046833913 8:118778498-118778520 CTCATCAGTCAAGGCTGTTTTGG + Intergenic
1047809725 8:128395561-128395583 ATCATAACTGTTGGATATTTGGG + Intergenic
1047828365 8:128603908-128603930 CTTATAAGGGATAGATATTTGGG + Intergenic
1047842819 8:128772472-128772494 CTCATTGGTGATGGGCATTTAGG - Intergenic
1048096754 8:131304084-131304106 CTTGTCATTGATGGACATTTAGG + Intergenic
1048582092 8:135737722-135737744 TCCATCATTGATGGGTATTTGGG + Intergenic
1049875308 8:145014227-145014249 TCTATCATTGATGGATATTTGGG + Intergenic
1050321136 9:4453596-4453618 TCTATCATTGATGGATATTTGGG - Intergenic
1050403067 9:5277223-5277245 CTCACCATTGATGGGCATTTAGG - Intergenic
1050886256 9:10770092-10770114 CCTATCATTGATGGACATTTGGG - Intergenic
1050915023 9:11121156-11121178 TCTATCATTGATGGATATTTGGG + Intergenic
1051054130 9:12964001-12964023 CTCTTCAATGAAGAATATTTGGG + Intergenic
1051321563 9:15910938-15910960 GTCTTCATTGATGGACATTTGGG + Intronic
1051532662 9:18122263-18122285 TTCATGAGTCATGGATATGTAGG - Intergenic
1051689339 9:19693287-19693309 CAAACCATTGATGGATATTTGGG - Intronic
1051692932 9:19735605-19735627 CTTATCATTGTTGGACATTTGGG - Intronic
1052078672 9:24176446-24176468 TCTATCATTGATGGATATTTAGG + Intergenic
1054803151 9:69372579-69372601 TTTATCTGTGATGGATATTTAGG + Intronic
1055603733 9:77947077-77947099 CCCAGCAGAGAAGGATATTTGGG - Intronic
1055790593 9:79919101-79919123 TCTATCATTGATGGATATTTGGG + Intergenic
1056644919 9:88402702-88402724 CTGCTCATTGATGGATACTTAGG + Intronic
1056723893 9:89095213-89095235 TTCATCAGTTAAGGATATTTGGG - Intronic
1056911505 9:90705183-90705205 CCCATCATTGATGAATATTTAGG - Intergenic
1057451850 9:95170045-95170067 ATCAACTGTGATGCATATTTTGG + Intronic
1058081444 9:100704872-100704894 TTTATCATTGATGGACATTTGGG + Intergenic
1058595455 9:106610713-106610735 CCTATCATTGATGGACATTTGGG - Intergenic
1058625434 9:106928801-106928823 CTCCTCAGTGATGGAGACTTGGG - Exonic
1059898412 9:118894675-118894697 TCTATCATTGATGGATATTTGGG - Intergenic
1060049167 9:120365030-120365052 TCTATCACTGATGGATATTTAGG - Intergenic
1060866401 9:127002366-127002388 TTCAATGGTGATGGATATTTTGG + Intronic
1062217178 9:135395554-135395576 CTCATCAGAGATAGAAATTCTGG + Intergenic
1185716994 X:2350827-2350849 CTTATCATTGATGGACATTTGGG - Intronic
1185911901 X:3989134-3989156 ATCATCATTGATGGGCATTTGGG + Intergenic
1186318073 X:8392686-8392708 TCTATCATTGATGGATATTTGGG - Intergenic
1188272418 X:28157110-28157132 TTTATCAGTGATGGACATTTGGG - Intergenic
1188495819 X:30781885-30781907 GACATCACTGATGGACATTTGGG - Intergenic
1188785903 X:34346181-34346203 CTCATTATTGATGGGCATTTAGG - Intergenic
1189229940 X:39444320-39444342 CCTATCATTGATGGACATTTGGG - Intergenic
1189735489 X:44065825-44065847 CCTATCATTGATGGACATTTGGG + Intergenic
1190231391 X:48584960-48584982 CTCATCTGCCATGGACATTTGGG + Intergenic
1190423358 X:50308597-50308619 CTCCTCAGTGTTGGGTGTTTTGG - Exonic
1190555366 X:51628855-51628877 TCCATCATTGATGGATATTTGGG - Intergenic
1190600164 X:52083620-52083642 CCTATCACTGATGGACATTTAGG + Intergenic
1191026754 X:55922213-55922235 TCTATCACTGATGGATATTTCGG - Intergenic
1191073212 X:56424452-56424474 CCTATCGTTGATGGATATTTGGG + Intergenic
1191111503 X:56806212-56806234 CTTATCATTGATGGGCATTTGGG + Intergenic
1191205012 X:57824344-57824366 CTTATCATTGATGGACATTTGGG + Intergenic
1191209354 X:57868891-57868913 CTTATCATTGATGGACATTTGGG - Intergenic
1191627710 X:63286394-63286416 CCTATCATTGATGGATATTTGGG + Intergenic
1191687616 X:63908538-63908560 TCTATCATTGATGGATATTTGGG - Intergenic
1191699015 X:64019807-64019829 CCTATCATTGATGGACATTTAGG - Intergenic
1191766091 X:64699652-64699674 CCCATCATTGATGGGCATTTGGG + Intergenic
1191816375 X:65250329-65250351 TCAATCATTGATGGATATTTGGG + Intergenic
1191936282 X:66430384-66430406 TTTATCATTGATGGACATTTGGG + Intergenic
1191986960 X:66992331-66992353 TCCATCATTGATGGACATTTGGG + Intergenic
1192044690 X:67659610-67659632 TTTATCATTGATGGACATTTGGG + Intronic
1192097712 X:68230512-68230534 TCTATCATTGATGGATATTTGGG - Intronic
1192125015 X:68493896-68493918 TCTATCATTGATGGATATTTGGG - Intergenic
1192558134 X:72106711-72106733 TCTATCATTGATGGATATTTGGG - Intergenic
1192581490 X:72286416-72286438 CTCCTTATTGATGGATATCTAGG + Intronic
1192635458 X:72811939-72811961 TTTATCATTGATGGACATTTGGG + Intronic
1192646256 X:72908864-72908886 TTTATCATTGATGGACATTTGGG - Intronic
1192843527 X:74882119-74882141 TCTATCATTGATGGATATTTGGG - Intronic
1193072201 X:77318244-77318266 TTTATCACTGATGGACATTTGGG - Intergenic
1193199914 X:78676688-78676710 ATCATCGTTGATGGACATTTAGG + Intergenic
1193446020 X:81603575-81603597 TCTATCATTGATGGATATTTGGG - Intergenic
1193464064 X:81825673-81825695 TCTATCACTGATGGATATTTAGG + Intergenic
1194008967 X:88534743-88534765 TCTATCACTGATGGATATTTGGG + Intergenic
1194085286 X:89519115-89519137 TCCATCACTGATGGAGATTTGGG + Intergenic
1194536676 X:95113741-95113763 CCTAGCATTGATGGATATTTAGG + Intergenic
1194825696 X:98560483-98560505 TCTATCATTGATGGATATTTGGG + Intergenic
1194854047 X:98906389-98906411 TTTATCATTGATGGATATTAGGG + Intergenic
1194929971 X:99875707-99875729 TTTATCAGTGATGGGCATTTTGG + Intergenic
1195572548 X:106412752-106412774 TCTATCATTGATGGATATTTGGG - Intergenic
1195661294 X:107381460-107381482 TTCCTTATTGATGGATATTTAGG + Intergenic
1195665599 X:107427454-107427476 TCTATCATTGATGGATATTTGGG - Intergenic
1195738563 X:108038607-108038629 CCTATCACTGATGGACATTTGGG - Intergenic
1195844930 X:109216409-109216431 TTCATCTGTGATGGACACTTAGG - Intergenic
1195947957 X:110235561-110235583 TCTATCAGTGATGGACATTTAGG - Intronic
1196019607 X:110976707-110976729 CCTATCATTGATGGACATTTGGG - Intronic
1196588914 X:117462593-117462615 TTTATCATTGATGGACATTTGGG + Intergenic
1196673666 X:118396401-118396423 CCAATCAGTGATGAACATTTGGG - Intronic
1196693239 X:118583027-118583049 GTCATCATTGTTGGACATTTGGG - Intronic
1197311276 X:124908567-124908589 CCCATCACTGATGGGCATTTGGG + Intronic
1197416811 X:126185612-126185634 TCTATCACTGATGGATATTTGGG + Intergenic
1197417624 X:126194299-126194321 TCTATCACTGATGGATATTTGGG - Intergenic
1197485886 X:127051216-127051238 CCTATCATTGATGGACATTTGGG + Intergenic
1197989462 X:132302105-132302127 CCCATCAGTGGTGTATTTTTTGG + Intergenic
1198521534 X:137458205-137458227 CTATCCATTGATGGATATTTGGG + Intergenic
1198657344 X:138929063-138929085 CCAATCAGTGATGCCTATTTGGG - Intronic
1198740677 X:139838971-139838993 TTCATCAGTTATGGACATTTGGG - Intronic
1200383659 X:155866311-155866333 CTCATCTGTGATGTAAACTTTGG - Intergenic
1200437929 Y:3174997-3175019 TCCATCACTGATGGAGATTTGGG + Intergenic
1200536205 Y:4400635-4400657 TTTATCATTGATGGACATTTGGG + Intergenic
1200718600 Y:6578272-6578294 TCTATCATTGATGGATATTTGGG - Intergenic
1200735925 Y:6795297-6795319 TCTATCAGTGATGGAAATTTGGG + Intergenic
1200853120 Y:7906515-7906537 CCTATCATTGTTGGATATTTGGG - Intergenic
1201535919 Y:15048107-15048129 TCTATCATTGATGGATATTTGGG + Intergenic
1201547846 Y:15185306-15185328 CTTATCACTGATGGACATTTGGG + Intergenic
1201712999 Y:17012777-17012799 CTCATCAGGGCTGCATATATTGG - Intergenic
1201751780 Y:17440085-17440107 TCTATCACTGATGGATATTTGGG + Intergenic
1201930057 Y:19334400-19334422 TCTATCACTGATGGATATTTGGG + Intergenic