ID: 1108013737

View in Genome Browser
Species Human (GRCh38)
Location 13:46051752-46051774
Sequence GTTTGTGAAGGGTAGTCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108013737 Original CRISPR GTTTGTGAAGGGTAGTCTTA AGG (reversed) Intronic
901350152 1:8588397-8588419 GTTTGGGAAGGGTAGGCCTTGGG - Intronic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
906403492 1:45522583-45522605 GTTTGTGGGGGGTAGTCATCAGG - Intronic
912184086 1:107253520-107253542 GTTAGAGAAGGGTACTCTTTTGG + Intronic
912838034 1:113014069-113014091 GTGTGTGAAGGGTTGTCATATGG - Intergenic
913959811 1:143329999-143330021 ATTTCTGAAGGGTAGTTTCATGG + Intergenic
914054170 1:144155572-144155594 ATTTCTGAAGGGTAGTTTCATGG + Intergenic
914124976 1:144810793-144810815 ATTTCTGAAGGGTAGTTTCATGG - Intergenic
916564030 1:165957697-165957719 GTTGGTCAAGGTTAGTCATATGG + Intergenic
917466832 1:175286768-175286790 TTTTGTCAAGGATATTCTTAAGG + Intergenic
917694302 1:177505337-177505359 GTTTGTTAAGGTAAGTCTTATGG - Intergenic
921321624 1:213945846-213945868 GTTTTTGAAGGGTAGGGGTAGGG - Intergenic
923988038 1:239403571-239403593 TTTTGAGAGGGGTAGTCTTTTGG + Intronic
1066009609 10:31182198-31182220 GTTTGTTAAGGGATGACTTAAGG + Intergenic
1067022506 10:42813861-42813883 ATTTCTGAAGGGTAGTTTCATGG + Intronic
1069023041 10:63510582-63510604 GTTTGTTAAGGTTTGTTTTATGG + Intergenic
1070130222 10:73650825-73650847 GTTTAGGAAGGGTAGTCTTTGGG - Intronic
1074834068 10:117272390-117272412 GTTTGTGAACGGCAGCCTGATGG + Intronic
1081662498 11:44896646-44896668 GATGGTGAAGGCTAGTCTTGGGG - Intronic
1084737951 11:71117949-71117971 GTTTATGGAGGGCAGTCTTATGG + Intronic
1088279365 11:108121237-108121259 GTTTGTGCTGGGTAGGCCTAAGG + Intergenic
1092574850 12:9770714-9770736 GGTTGTGATGGTTAATCTTATGG + Intergenic
1092663207 12:10763033-10763055 ATATCTGAAGGGCAGTCTTAGGG + Intergenic
1093115669 12:15207789-15207811 TTTTGTGAAGGGCTGTCATAAGG + Intronic
1095601087 12:44013845-44013867 GTCAGTGAAGTGAAGTCTTAGGG - Intronic
1098021645 12:66162170-66162192 GTTTGTGAAGGGAATTCATGGGG - Intronic
1098871293 12:75820090-75820112 GTTTATGGAGAGTAGTCTAAAGG - Intergenic
1100361242 12:93881711-93881733 GTTTCTGAAGATTAGTCTCAGGG - Intronic
1101065290 12:101014556-101014578 GTTTGTGAAGGGAACTGTGAGGG - Intronic
1102549766 12:113683309-113683331 GTTTGAGAAGTGTAATTTTAAGG - Intergenic
1105040839 12:132959714-132959736 TTTTGTTGAGGGGAGTCTTATGG - Intergenic
1108013737 13:46051752-46051774 GTTTGTGAAGGGTAGTCTTAAGG - Intronic
1108134515 13:47340650-47340672 ATTTGTGAAGCTTAGTTTTATGG - Intergenic
1108799393 13:54075392-54075414 TTTTGTGAATGGTACCCTTAAGG - Intergenic
1109920401 13:69050743-69050765 GTTTATGAAGCTTAGTCTGAAGG - Intergenic
1112573492 13:100614928-100614950 CCTTGTGAAGGGTGGTCTCAGGG + Intronic
1113487919 13:110668566-110668588 CTTAGTGACGGGTCGTCTTAGGG + Intronic
1114287922 14:21262705-21262727 GTTTGTGAGGGGTAGTGTACAGG + Intronic
1117515369 14:56495298-56495320 GCTTGTGAAGTGTGGTCTTCAGG + Intronic
1117794799 14:59381473-59381495 GGTTGGGGAGGGTAGTCTGAGGG - Intergenic
1119099351 14:71865921-71865943 GTTTCTGATGGGTAGGCCTATGG + Intergenic
1119867582 14:77986693-77986715 GTTTGAGTAGGGTGGTTTTATGG - Intergenic
1121061427 14:90913728-90913750 GTTAGGGAAAGGTAGTCTAAGGG - Intronic
1122048631 14:99040617-99040639 TTTTGGGAAGGGTATTATTACGG - Intergenic
1123423615 15:20150753-20150775 ATTTCTGAAGGGTAGTTTCATGG + Intergenic
1123532837 15:21157274-21157296 ATTTCTGAAGGGTAGTTTCATGG + Intergenic
1130416257 15:83697423-83697445 GCGTGTGAAGGGCAGTCTTGTGG - Intronic
1131125096 15:89853215-89853237 GTGTGTAAAGGATAGTCTTAAGG + Intronic
1136861205 16:33704851-33704873 ATTTCTGAAGGGTAGTTTCATGG - Intergenic
1137792525 16:51186924-51186946 GTTTTTGAAGGGTAGTGTTTTGG + Intergenic
1203122702 16_KI270728v1_random:1553042-1553064 ATTTCTGAAGGGTAGTTTCATGG - Intergenic
1150169821 17:62981669-62981691 GTGTTTGAAGAGTAGTCTTACGG - Intergenic
1150902241 17:69293430-69293452 GCTTGTGAAGGTTAATTTTATGG + Intronic
1153748444 18:8204794-8204816 TTTTGTGATGGGAAGTGTTAGGG - Intronic
1157952758 18:52058095-52058117 ATTTGTCAAGGTTAGTGTTATGG + Intergenic
1158926111 18:62262876-62262898 GTGTTGGCAGGGTAGTCTTAGGG + Intronic
1165928987 19:39343842-39343864 GTTAGTGAAGGGGAGTTCTACGG - Intronic
1166549580 19:43656411-43656433 GTTTGTTAAGTGCAGTCTTAGGG + Intronic
1166818479 19:45561456-45561478 GATGGTGAAGGGTCGTCATAAGG + Intronic
1202693648 1_KI270712v1_random:108247-108269 ATTTCTGAAGGGTAGTTTCATGG + Intergenic
926233128 2:11019816-11019838 GCTGGTGAAGGGTTGTCTCAAGG + Intergenic
926617581 2:15012796-15012818 ATTTCTGAAGGGTAGTTTTGCGG - Intergenic
928502461 2:31911476-31911498 CTTTGTGTTGGATAGTCTTACGG - Intronic
932859822 2:75278482-75278504 GATTGTGAAGGGTAGGAGTAAGG - Intergenic
933283118 2:80354596-80354618 GTTTTAGAAGAGAAGTCTTAGGG + Intronic
933952918 2:87346332-87346354 ATTTCTGAAGGGTAGTTTCATGG - Intergenic
934237155 2:90242676-90242698 ATTTCTGAAGGGTAGTTTCATGG - Intergenic
934459577 2:94205977-94205999 ATTTCTGAAGGGTAGTTTCATGG - Intergenic
936569687 2:113603200-113603222 GTTAGGGTAGGGTAGTGTTAGGG - Intergenic
939175681 2:138745083-138745105 GCTTGAGAAGGTTAGTCTTAGGG - Intronic
939242325 2:139576918-139576940 GGCTGTGAAGGGTAGTATGAGGG - Intergenic
942158585 2:173157983-173158005 GTTTGTGAAGTGGAGTGGTATGG + Intronic
943308443 2:186296939-186296961 GCTTGTGATAGGTAATCTTAGGG - Intergenic
1170168008 20:13381532-13381554 GTCTGTTAAGGATAGTTTTAAGG + Intergenic
1170810951 20:19674093-19674115 GCTTGTGAAGGGAATTCCTAGGG + Intronic
1171528073 20:25831345-25831367 GATTATGATGGGTAGTCTTTGGG - Intronic
1171548753 20:26024535-26024557 GATTATGATGGGTAGTCTTTGGG + Intergenic
1175734509 20:61376023-61376045 GTTTGTGGATGGTAGTGTGATGG + Intronic
1178510475 21:33201098-33201120 ATATCTGAAGGGTTGTCTTAAGG + Intergenic
1181356618 22:22300484-22300506 ATTTCTGAAGGGTAGTTTCATGG + Intergenic
1182263283 22:29091860-29091882 GTCTGTGATGGGAAGTATTAGGG + Intronic
1182925345 22:34117536-34117558 ATTTGTTAAGGTTTGTCTTATGG + Intergenic
952038939 3:29238327-29238349 GTATATGAAGGGTAATTTTAAGG + Intergenic
952244487 3:31571220-31571242 GGATTTTAAGGGTAGTCTTAAGG + Intronic
953471841 3:43174035-43174057 GTTTTTCAAAGGTAGTCTTGGGG - Intergenic
957553375 3:81735371-81735393 GTTAGTGAAGGGCAGTTTCAGGG + Intronic
957945145 3:87053938-87053960 GTTTGTTAAGGGTAGCTTTTAGG - Intergenic
959116818 3:102188206-102188228 GCTTGTGAAGGGAAGTCATCAGG + Intronic
959159271 3:102704124-102704146 GCTAGTGAAGGCTAGTCTCAGGG + Intergenic
959551052 3:107657891-107657913 CTTTGTTAAGGGAAGTCTAAAGG + Intronic
959925154 3:111912979-111913001 GTTTCTGAAGGGTGGGGTTAGGG - Intronic
959934025 3:112011588-112011610 GTTTGGGTATGGTTGTCTTAGGG + Intronic
960247830 3:115418989-115419011 GTATTTGAAGGGCAGACTTATGG + Intergenic
960528754 3:118740014-118740036 GTTTGGGCAGGATAGTCTTTTGG - Intergenic
962391360 3:134975418-134975440 GAGAGTGAAGGGTAGGCTTAGGG + Intronic
963855820 3:150252144-150252166 GTTTGTGAATGTTTGTTTTAGGG - Intergenic
965476756 3:169165038-169165060 GTTTATGAAAGTGAGTCTTAAGG + Intronic
965515325 3:169615546-169615568 GTGTGTGAGGAGTAATCTTATGG - Intronic
965861329 3:173154448-173154470 TTTTGTTAAGGGCAGTCCTAGGG + Intergenic
971642847 4:29157856-29157878 GTTTTTCAAGGGTAGTCTGGTGG + Intergenic
972941972 4:44206831-44206853 ATTTGTGAAGGATTGTTTTAAGG + Intronic
974459922 4:62174163-62174185 GAGTGTGAAGGGCAGGCTTAGGG - Intergenic
980322989 4:131303152-131303174 CTTTGTGCAGGATAGTCTTCTGG - Intergenic
981453944 4:144932305-144932327 GTTTCAGAAGGCTAGTCTTCAGG + Intergenic
981890069 4:149725976-149725998 GTATGTGAAGGGTAGAATAAAGG - Intergenic
983126829 4:163963449-163963471 GTTTATAAAGGGAAGTTTTATGG + Intronic
983216643 4:165008177-165008199 GTTTGTGAAGGGTGGTATTGGGG + Intergenic
989010887 5:36871552-36871574 GTTTCAGAAAGGTAATCTTAAGG - Intergenic
989494151 5:42091620-42091642 GTATCTGAAGTGTAGTTTTAAGG + Intergenic
993942481 5:94076781-94076803 GTTAGTGAAGGGAAGTCTCCTGG - Intronic
994085580 5:95754546-95754568 ATTTGTGAAGGGTTGTTTGAAGG - Intronic
995999784 5:118345718-118345740 ATTTGTAAAGGGTAGTGTTGTGG + Intergenic
996606999 5:125334962-125334984 GTGTGTGCAGGGTTGTTTTAGGG + Intergenic
998953448 5:147414565-147414587 TTTTGGGAAGGGTAGTGTTTGGG - Intronic
1003065656 6:2902142-2902164 GTTTGTGAAGAGTTGACTTTGGG - Intronic
1003661456 6:8065805-8065827 GTGTCTGAAGGGGAGTCTTGAGG + Intronic
1007818416 6:44541572-44541594 GTTTATGAGGGGAAGTCTGATGG + Intergenic
1008563651 6:52746643-52746665 GTCTGTGAAGGGCAGGCTGATGG + Intergenic
1008568089 6:52788945-52788967 GTCTGTGAAGGGCAGGCTGATGG + Intergenic
1008572277 6:52827525-52827547 GTCTGTGAAGGGCAGGCTGATGG + Intergenic
1008579526 6:52894221-52894243 GTCTGTGAAGGGCAGGCTGATGG + Intronic
1013687807 6:112605836-112605858 GGCTGTGAAGGGTAGTGTTGGGG + Intergenic
1017687431 6:156927606-156927628 GTTTGTTACTGGCAGTCTTATGG - Intronic
1017866185 6:158445353-158445375 GTTTTTGGGGGGTAGTTTTATGG + Intronic
1022112102 7:27238198-27238220 CTTTGTGGAGGGTTGCCTTATGG + Intergenic
1027355189 7:77347340-77347362 GGGTGTGGAGGGTAGTCTTGGGG + Intronic
1027735917 7:81932837-81932859 GTTTTTCAAGGGTAGTTTGATGG + Intergenic
1028365295 7:90022191-90022213 GTTTATGAAGGGATGTATTATGG - Intergenic
1028461184 7:91094821-91094843 GCTAATGAAGGGTAGTCTGATGG - Intronic
1029356595 7:100056789-100056811 GTTTTTGTATGGTAGTTTTATGG + Intronic
1030990922 7:116298963-116298985 GTCTGGGAAGGGTAGTGATAGGG + Intronic
1032286759 7:130543494-130543516 GTTTATGAAGCGGAGTCTGAAGG + Intronic
1043288190 8:78561564-78561586 GTTTGTGCCAGGCAGTCTTAGGG + Intronic
1043543912 8:81294307-81294329 ATTTGTTAAGGGAAGTGTTAGGG - Intergenic
1043681806 8:83037043-83037065 GTTTTTAAAAGGTAGTCATAGGG + Intergenic
1043760153 8:84058459-84058481 GTTTGGGAAGGGTAGTGGGAGGG - Intergenic
1051591519 9:18780444-18780466 GTTTGAGAAGGGCAAACTTAAGG + Intronic
1053578520 9:39378312-39378334 GCCTGTGAAGTGTATTCTTATGG + Intergenic
1053690082 9:40581785-40581807 ATTTCTGAAGGGTAGTTTCATGG - Intergenic
1054301332 9:63382745-63382767 ATTTCTGAAGGGTAGTTTCATGG - Intergenic
1054586241 9:66969768-66969790 GCCTGTGAAGTGTATTCTTATGG - Intergenic
1055966158 9:81867014-81867036 GTTTCTGATGGCTAGTCTAAGGG + Intergenic
1057749071 9:97776161-97776183 GTTGGTGAAGGGTGATCCTAGGG + Intergenic
1058581303 9:106461139-106461161 GTTCATGAAGATTAGTCTTAGGG + Intergenic
1058922018 9:109626137-109626159 GTTTGTGAAGGGAAGAGTCAAGG - Intergenic
1059268172 9:113055635-113055657 GTTTGTGAAGGTTAGTGATTGGG - Intronic
1185502717 X:610632-610654 GGATGTGAAGGGGAGTTTTAGGG - Intergenic
1190224210 X:48533187-48533209 GTTTGTGATGGGAAGTCTATAGG - Intergenic
1200914379 Y:8558535-8558557 CTTTTTCAAGGGTAGTCATATGG - Intergenic
1201142718 Y:11041864-11041886 GTTTATGGAGGGCAGTCTTGTGG + Intergenic
1201864498 Y:18634781-18634803 GTTTAAGAAATGTAGTCTTAAGG + Intergenic
1201868824 Y:18685597-18685619 GTTTAAGAAATGTAGTCTTAAGG - Intergenic
1202083792 Y:21113557-21113579 GTCTGGGAAGGGTAGTGTGAGGG - Intergenic