ID: 1108013891

View in Genome Browser
Species Human (GRCh38)
Location 13:46052749-46052771
Sequence GCCTGGGTCTACAGAGGAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108013891_1108013898 28 Left 1108013891 13:46052749-46052771 CCTGTTCCTCTGTAGACCCAGGC 0: 1
1: 0
2: 2
3: 28
4: 322
Right 1108013898 13:46052800-46052822 TGCGCAGACACCACCCTTCGTGG 0: 1
1: 0
2: 0
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108013891 Original CRISPR GCCTGGGTCTACAGAGGAAC AGG (reversed) Exonic
903059541 1:20660543-20660565 GCCTGGGTGGAAAGAGGAAATGG - Intronic
903374147 1:22855200-22855222 GCCTGGGTTCACAGAGCAAATGG + Intronic
904517532 1:31067820-31067842 GCCTCGGCCTCCAGAGTAACTGG - Intergenic
904773009 1:32891356-32891378 GGCTGGGTCTTGAGAAGAACTGG - Intronic
906941441 1:50259254-50259276 GCCTAGGTCTGGAGATGAACTGG - Intergenic
907094225 1:51761508-51761530 TCTTGGGGCTAAAGAGGAACAGG + Intronic
907168884 1:52442051-52442073 GCCTTGGCCTCCAGAGTAACTGG - Intronic
910624062 1:89287567-89287589 GACTGGGTTTAGAGAGGGACAGG - Intergenic
911092597 1:94029717-94029739 GCCTGGGTCTAAAGAGGAGGAGG - Intronic
911112850 1:94210170-94210192 GGCTGGGTATAAAGAGTAACTGG + Intronic
912936738 1:114009982-114010004 GCCTAGGTCTACACAGGGTCAGG - Intergenic
914893219 1:151647091-151647113 GCCTGGGTCTACTGACAGACAGG + Intronic
915896688 1:159816779-159816801 GCCTAGGTCTACACAGGGTCAGG - Intergenic
917547855 1:175991768-175991790 GCCTAGGTCTACACAGGGTCAGG + Intronic
919406422 1:197190031-197190053 GCCTCAGTCTCCAGAGCAACTGG + Intronic
920153348 1:203927650-203927672 GCCTAGGCCTACACAGGATCGGG + Intergenic
920180223 1:204127853-204127875 GCCTGGGGCCTCAGAGGAATTGG + Intergenic
920328458 1:205185906-205185928 GCCTGAGCCTACAGAGTAGCTGG - Intronic
921788853 1:219266331-219266353 GCCTAGGCCTACAGAGGATCAGG + Intergenic
923169046 1:231396200-231396222 GCCTGGGTCAGTAGAGGAAGGGG - Intronic
923417897 1:233782683-233782705 GCCTGGGCCTACACAGGGTCAGG + Intergenic
923768275 1:236913122-236913144 GCCTCGGCCTCCAGAGTAACAGG - Intergenic
924370458 1:243343074-243343096 GCCTCAGCCTCCAGAGGAACTGG + Intronic
924539481 1:244968330-244968352 GCATGGGGCCACAGAGGAAAAGG + Intergenic
1062893738 10:1087004-1087026 GCCTGTGTGCACAGAGGGACAGG + Intronic
1063126799 10:3142857-3142879 ACCTGGGGCCACAGAGGGACAGG - Intronic
1063387364 10:5624482-5624504 TCCTGGGGCTGCATAGGAACAGG - Intergenic
1063962214 10:11315930-11315952 TCCTTGGTCTGCAGAGTAACAGG + Intronic
1064476069 10:15690354-15690376 GCATGGCTCTGCAGAGGAAGAGG - Intronic
1065360712 10:24886724-24886746 GCCTCAGTCTCCAGAGTAACTGG + Intronic
1066995211 10:42556576-42556598 GCCTGGGTCTCCCGAGTAGCTGG + Intergenic
1068484424 10:57638958-57638980 GCCTAGGCCTACAGAGGGTCAGG - Intergenic
1068992430 10:63163867-63163889 GCCTCAGTCTACAGAGTAGCTGG + Intergenic
1069709519 10:70479534-70479556 ACCCGGGCCTACAGAGGAAGAGG - Intronic
1070599966 10:77858707-77858729 GCCTAGGGCTACAGAGGGTCAGG - Intronic
1070701602 10:78605662-78605684 GCCTAGGTCTACAGAGGGTCAGG - Intergenic
1072454668 10:95565202-95565224 ACCTGGGTCCACAGGGAAACGGG + Intergenic
1073287763 10:102398837-102398859 GCCGGGGGCTACGGAGGAGCTGG + Exonic
1073356692 10:102860691-102860713 GCCTGAGACTACAGAAGAAGTGG + Intronic
1073906709 10:108289703-108289725 GCCAAGGCCTACACAGGAACAGG + Intergenic
1074293682 10:112161669-112161691 GCCTGTGTCTGTAGAGGAGCAGG + Exonic
1074876721 10:117619330-117619352 CCCTGAGTCTGCAGAGGAGCCGG + Intergenic
1076831152 10:132994975-132994997 GCCTGGGCCTTCAGAGGCAGAGG - Intergenic
1077057158 11:599767-599789 TCCTGGGTCTCCAGAGGACTCGG + Intronic
1077625253 11:3765684-3765706 GCCTTGGTCTCCTGAGTAACTGG - Intronic
1078451864 11:11446520-11446542 TCCTGGGTCTGGAGAGGAGCTGG - Intronic
1079577646 11:22022867-22022889 GCCTCAGTCTACAGAGTAGCTGG + Intergenic
1079666111 11:23107744-23107766 GCCTGGATCTACAAAAGAAGAGG + Intergenic
1080642300 11:34165019-34165041 CCCTGGGTCTCCAGAGGGAAGGG + Intronic
1080788867 11:35501627-35501649 GCCTAGGCCTACACAGGATCAGG + Intronic
1083204686 11:61141251-61141273 GCCTGGGCCTCCGGAGTAACTGG - Intronic
1084743293 11:71152670-71152692 TGCTGGGTCTGAAGAGGAACCGG + Intronic
1087432456 11:98070757-98070779 GCCTGGGTCTACATAGTGTCAGG - Intergenic
1088056241 11:105583055-105583077 GCCTAGGTCTACAGAGGGTCAGG - Intergenic
1088126046 11:106424443-106424465 GTCTCGGTTTACAGAGGAACTGG + Intergenic
1088266154 11:107989803-107989825 GCCTAGGCCTACACAGGATCAGG + Intergenic
1088462659 11:110098181-110098203 GCCTAGGTCTACACAGGGTCAGG - Intronic
1091667601 12:2430644-2430666 GCTTGGGTTTACAGGGGAAAGGG - Intronic
1093037094 12:14342271-14342293 GCCTCGGCCTCCAGAGAAACTGG - Intergenic
1093439046 12:19171860-19171882 GCCTGGGGCTACACAGGGTCAGG + Intronic
1093797522 12:23330687-23330709 GCCTGGGTCAACAGCTGAAATGG - Intergenic
1094078547 12:26506257-26506279 GCCTGGGCCTCCTGAGTAACTGG - Intronic
1096286549 12:50305575-50305597 GCCTCAGCCTACAGAGTAACTGG + Intergenic
1096660286 12:53119822-53119844 GCCTGTGAGTACAGAGAAACAGG - Intronic
1096986163 12:55759523-55759545 GCCTCGGTCTCCAGAGTAGCTGG + Intronic
1099322182 12:81163703-81163725 GCCTAGGCCTACACAGGATCAGG - Intronic
1099541934 12:83921756-83921778 GCCTAGGTCTACACAGGGTCAGG - Intergenic
1101177555 12:102170972-102170994 GCCTAGGTCTACACAGGGTCAGG + Intronic
1101553587 12:105785857-105785879 GCCTGGGTCCACTTAGGCACTGG - Intergenic
1101909833 12:108853061-108853083 GCCTGGCTCTGCGGAGGAAGTGG - Intronic
1102569722 12:113820062-113820084 GGCTGGGTGTAAAGAGGAGCTGG + Intronic
1102595677 12:113990896-113990918 GCCTGGGAGTAGAGAGGAAGAGG + Intergenic
1102689505 12:114749379-114749401 GCCTGTGTTCACAGAGGATCAGG - Intergenic
1103329699 12:120145385-120145407 GTCAGGGTCCACAGTGGAACAGG - Intronic
1103646151 12:122394372-122394394 GCCTGAGCCTCCAGAGTAACTGG - Intronic
1106310232 13:28547875-28547897 TGCTGGGGCTAGAGAGGAACTGG + Intergenic
1107492430 13:40893766-40893788 GGGTGGGTCTCCAGAGGCACAGG + Intergenic
1108013891 13:46052749-46052771 GCCTGGGTCTACAGAGGAACAGG - Exonic
1108233678 13:48378410-48378432 GCCTAGGCCTACACAGGATCAGG + Intronic
1113962429 13:114133134-114133156 GCCGGGGTCTGCAGGGGGACTGG - Intergenic
1113962448 13:114133176-114133198 GCCGGGGTCTGCAGGGGGACTGG - Intergenic
1113962466 13:114133217-114133239 GCCGGGGTCTGCAGGGGGACTGG - Intergenic
1113962483 13:114133255-114133277 GCCGGGGTCTGCAGGGGGACTGG - Intergenic
1113962501 13:114133294-114133316 GCCGGGGTCTGCAGGGGGACTGG - Intergenic
1113962519 13:114133333-114133355 GCCGGGGTCTGCAGGGGGACTGG - Intergenic
1113962601 13:114133532-114133554 GCCGGGGTCTGCAGGGGGACTGG - Intergenic
1113962638 13:114133612-114133634 GCCGGGGTCTGCAGGGGAACTGG - Intergenic
1113962655 13:114133651-114133673 GCCGGGGTCTGCAGGGGGACTGG - Intergenic
1113962671 13:114133690-114133712 GCCGGGGTCTGCAGGGGGACTGG - Intergenic
1115291781 14:31780175-31780197 GCCTCAGTCTCCAGAGTAACTGG + Intronic
1116068710 14:40015528-40015550 GCCTGGGTCTGTGGAGTAACTGG + Intergenic
1117455826 14:55896177-55896199 GCCTGGGTGCACTGAGGAATTGG + Intergenic
1117750109 14:58912679-58912701 GCCTAGGTCTACATAGGGTCTGG - Intergenic
1118398584 14:65358566-65358588 ACTTCGGTCTACAGAGTAACTGG + Intergenic
1118589219 14:67388792-67388814 GCCTCAGTCTCCCGAGGAACTGG + Intronic
1119548708 14:75492594-75492616 GCCTCCGTCTCCAGAGTAACTGG - Intergenic
1119693289 14:76693324-76693346 GCCTGGGACTCCTGAGGAGCTGG - Intergenic
1121232053 14:92365294-92365316 GACTGGGTCTGCAGAGCAGCTGG + Intronic
1122714273 14:103684572-103684594 GTCTGGGTCTGCAGAGGCTCAGG + Intronic
1125444154 15:39735869-39735891 GCCTAGGTCTACACAGGGTCAGG + Intronic
1126067561 15:44837708-44837730 GCTTGGGTCTAGGGAAGAACTGG + Intergenic
1126092317 15:45063174-45063196 GCTTGGGTCTAGGGAAGAACTGG - Intronic
1126526612 15:49663227-49663249 GCATGGGTTTACAGGGGAAAAGG - Intergenic
1126767853 15:52026933-52026955 GCCTGGGCCTTCAGAGTAGCTGG - Intronic
1127943454 15:63725358-63725380 CCCTGTGTCTCCAGAGGAACAGG - Exonic
1128235450 15:66064252-66064274 GCCTCAGCCTACAGAGTAACTGG - Intronic
1129121345 15:73398661-73398683 GCCTCAGTCTACTGAGTAACTGG - Intergenic
1131775775 15:95796884-95796906 GCCTCAGTCTCCAGAGTAACTGG - Intergenic
1133303266 16:4795737-4795759 GGCTGTGTCCACAGAGGAGCTGG + Exonic
1134038839 16:11052499-11052521 GCCTGGGGGTGCAGAGGAAGTGG + Intronic
1135539838 16:23321392-23321414 GGCGGGGCCTTCAGAGGAACAGG - Intronic
1136144637 16:28309228-28309250 GCCTGGGGCTTCAAAGGATCGGG - Intronic
1136358416 16:29761691-29761713 GCCTCAGTCTACAGAGCAGCTGG - Intergenic
1136548522 16:30968991-30969013 GCCTCGGTCTCCTGAGTAACTGG - Intronic
1138086268 16:54136419-54136441 GCCTGGGTCTTCAGAGGCAGAGG - Intergenic
1138506379 16:57480294-57480316 GCCTGGGGCTGGAGAGAAACAGG - Intronic
1139002388 16:62528442-62528464 GCCTAGGTCTCCACAGGATCAGG + Intergenic
1139200047 16:64965429-64965451 GCCTGTGCCTACACAGGATCAGG + Intronic
1140757756 16:78083790-78083812 GCCTCGGTCTCCTGAGTAACTGG - Intergenic
1141560206 16:84862856-84862878 GGCTGGGACAACAGAGGACCTGG - Intronic
1143451456 17:7039126-7039148 GCTTGGGTTTGCAGAGGACCTGG + Intronic
1143564282 17:7712125-7712147 GCCTGGGTCTTGAGAGGTGCGGG + Intergenic
1143764146 17:9126706-9126728 GGCTGTGGCTAAAGAGGAACAGG + Intronic
1143897692 17:10149215-10149237 GCCTGAGCCTACAGAGTAGCTGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144555405 17:16278168-16278190 GCCTCAGTCTACCGAGTAACTGG + Intronic
1146706612 17:35004911-35004933 GCCTGGAAGTACAAAGGAACAGG - Exonic
1147217054 17:38906897-38906919 GCCTGTGTCCACAGAGGCCCAGG + Intronic
1147320747 17:39644385-39644407 GCCTGGCACCACAGAGTAACTGG - Intronic
1147570024 17:41564364-41564386 GCCTGTGACTACAGAAGAAGTGG + Intergenic
1149372500 17:56009120-56009142 GCCTGGGTCTTCAGAGAGACTGG - Intergenic
1149779500 17:59386210-59386232 GCCTGAGCCTCCAGAGTAACTGG - Intronic
1150055082 17:62007124-62007146 GCCTCAGCCTCCAGAGGAACTGG - Intronic
1150071319 17:62152831-62152853 GCCTCAGCCTCCAGAGGAACTGG + Intergenic
1150755960 17:67913883-67913905 GCCTGTGGCTACAGAGACACAGG + Intronic
1150796902 17:68246251-68246273 GCCTCAGTCTACAGAGTAGCTGG - Intergenic
1152183823 17:78841405-78841427 GCCTGGGGCTGCCGAGGAAATGG + Intronic
1152187220 17:78865219-78865241 GGCTGGGCAAACAGAGGAACAGG + Intronic
1152519724 17:80848192-80848214 GCCTTGGCCTACTGAGGAGCTGG - Intronic
1152784412 17:82240491-82240513 ACCTGGGCTTACAGAGGTACTGG + Intronic
1154197063 18:12274347-12274369 GCCTGGGAGCCCAGAGGAACAGG - Intronic
1155129248 18:22913993-22914015 TTCTGGATCTACAGAAGAACCGG + Intronic
1155663973 18:28284759-28284781 GCCTAGGCCTACAAAGGATCAGG + Intergenic
1156263883 18:35468741-35468763 GCCTGGGTGAAAAGAGGCACAGG + Exonic
1158700206 18:59738449-59738471 GCCTTGGTCTTCAGAGTAGCTGG + Intergenic
1160576390 18:79856658-79856680 GCCTGGGACTGCAGAGGACAGGG + Intergenic
1161362614 19:3859488-3859510 GCCAGGGTCTCTAGAGGGACAGG - Intronic
1162306485 19:9877416-9877438 GCCTCGGCCTACAGAGTAGCTGG - Intronic
1163845295 19:19635153-19635175 GCCTGTGTCCACAGAGGATCAGG + Exonic
1164931616 19:32180095-32180117 GCCTTGGCCTCCAGAGAAACTGG - Intergenic
1165019357 19:32910727-32910749 GCCTAGGCCTGCAGAGGGACAGG + Intronic
1165200895 19:34144017-34144039 GCCCGGGTCTACACGGGATCAGG + Intergenic
1165852546 19:38858248-38858270 GCCTGAGTCTCCTGAGGACCTGG - Intergenic
1167058761 19:47130427-47130449 ACATGGGGCTACAGAGTAACAGG - Intronic
1167359044 19:49020202-49020224 GCCAGGGACTGCAGAGGAAAGGG - Intergenic
1167366727 19:49058439-49058461 GCCAGGGACTGCAGAGGAAAGGG - Exonic
1168175610 19:54625477-54625499 CCCTTGGCCTACAGAGGCACAGG - Intronic
924963690 2:57213-57235 GCCTGGGCCCAGAGAGGACCTGG + Intergenic
926288336 2:11508420-11508442 GCGTGGGTCTTCAGCAGAACGGG + Intergenic
927372707 2:22375517-22375539 GCCTAGGTCTAAAGAGGCAAGGG - Intergenic
927654834 2:24936363-24936385 GCCTCAGTCTCCTGAGGAACAGG - Intergenic
928121122 2:28584261-28584283 GCATGGATCTGCAGAGGAGCAGG - Intronic
929515641 2:42604154-42604176 GCCTGAGTCTCCAGAGTAGCTGG + Intronic
929575005 2:43046103-43046125 ACCAGGGTTTAGAGAGGAACAGG - Intergenic
929611621 2:43275117-43275139 GCCTCAGTCTCCAGAGTAACTGG + Intronic
932375822 2:71234885-71234907 GCCTCGGCCTCCAGAGTAACTGG - Intergenic
932562059 2:72881875-72881897 GCCTGGGTTTTCTGAAGAACAGG - Intergenic
933735330 2:85489112-85489134 GCCTGGGTCTACTGACAGACAGG + Intergenic
933960221 2:87403534-87403556 GCCTGGGCCTACCGAGTAGCTGG - Intergenic
934152370 2:89159692-89159714 GCCTGGCTGAACAGAGAAACTGG - Intergenic
934895486 2:98116188-98116210 GCCTGGGTCTGCACAGGGCCTGG - Intronic
935371781 2:102355641-102355663 GCCCGGCTCTTCAGAGGAAGAGG - Intronic
935423611 2:102896179-102896201 GCCTAGGTCTACACAGGGTCAGG - Intergenic
936093155 2:109513774-109513796 GCCTGTGGCTACAGAGGATGTGG + Intergenic
936533364 2:113292101-113292123 GCCTGGGGATGGAGAGGAACTGG - Intergenic
937225615 2:120367174-120367196 GCCTGGGTCACCAGGGGAATGGG + Intergenic
937892308 2:126948155-126948177 GCCTGGGACTGGAGAGGGACAGG - Intergenic
938083742 2:128384834-128384856 GCCTGGGCGTCCAGAGGAAAGGG + Intergenic
942872730 2:180754930-180754952 GCCTAGGCCTACAAAGGATCAGG + Intergenic
944317525 2:198299140-198299162 GCCTAGGCCTACAGAGGGTCAGG - Intronic
944508221 2:200437426-200437448 GCCTGGGCCCACAGCTGAACTGG + Intronic
944836884 2:203588682-203588704 GCCTCGGTCTCCTGAGTAACTGG + Intergenic
945054564 2:205857125-205857147 GCCTCGGTCTCCAGAGTAGCTGG - Intergenic
945106647 2:206322523-206322545 GCCTGGGCCTACACAGGGTCAGG + Intergenic
945637743 2:212378005-212378027 GCCTAGGCCTACACAGGATCAGG + Intronic
946172821 2:217905591-217905613 GCCCTGGGCTGCAGAGGAACAGG - Intronic
947412698 2:229858246-229858268 GCCTTGGCCTCCAGAGTAACTGG - Intronic
948261143 2:236605307-236605329 GGCTGTTTCCACAGAGGAACAGG - Intergenic
948994713 2:241572551-241572573 GCCTGGGTCTGCGGAGGAACGGG - Exonic
1169346937 20:4836087-4836109 GCCTGGGTCTGGGGAGGAAGAGG - Intergenic
1170971077 20:21117054-21117076 GACTGGGGGTACAGAGGAATGGG + Intergenic
1171413773 20:24963827-24963849 GGCTGAGTCTGCAGAGGAAGGGG + Exonic
1172626334 20:36349591-36349613 GCCTGGTTTGACAGAGAAACAGG + Intronic
1176000569 20:62829653-62829675 GCCTGGCTCTCCAGAGGGGCCGG - Exonic
1176938176 21:14890928-14890950 GCCTAGGTCTACACAGGATCAGG + Intergenic
1178053775 21:28776496-28776518 TCATGGGTCTCTAGAGGAACAGG + Intergenic
1178306623 21:31496066-31496088 GCCTAGGCCTACACAGGAGCAGG - Intronic
1179354024 21:40641931-40641953 GCCTCGGTCTACCGAGTAGCTGG - Intronic
1180359159 22:11871016-11871038 GCCTTGGTCTCCTGAGCAACTGG - Intergenic
1181776324 22:25162260-25162282 GCCTGGGCCCACAGGGGCACTGG + Intronic
1182911979 22:33992253-33992275 GCCTGACTATACAGAGGAACTGG + Intergenic
1184150766 22:42637096-42637118 TCCTGGCTCTTCAGAGGAAATGG - Intronic
1184925470 22:47633369-47633391 GAGTGGGTCTGCAGAGAAACCGG + Intergenic
1185301294 22:50082341-50082363 GCCGGGGTTCACAGAGGACCAGG + Intronic
950859654 3:16136614-16136636 TCCAGGGTCTTCAGAAGAACAGG - Intergenic
951250380 3:20387537-20387559 GCCTCGGCCTCCAGAGTAACTGG + Intergenic
951475164 3:23097274-23097296 GCCTAGGTCTACACAGGAGTCGG - Intergenic
953247695 3:41210494-41210516 GCCTAGGCCTACAGAGGGTCAGG + Intronic
953720198 3:45348322-45348344 GGGTGGGTATACAGAGGAATTGG + Intergenic
953739230 3:45522607-45522629 GCCTGGGACTACAGGTGCACAGG - Intronic
954753952 3:52828968-52828990 ACCTGGGGCCACACAGGAACAGG - Intronic
955226946 3:57068056-57068078 GCCTTGGCCTCCAGAGTAACTGG - Intronic
955472586 3:59301322-59301344 GCCTGAGCCTCCAGAGGAGCTGG + Intergenic
957805972 3:85149620-85149642 GCCTCAGTCTCCAGAGTAACTGG - Intronic
959569922 3:107872372-107872394 GCCTTGGCCTACACAGGGACAGG + Intergenic
960117118 3:113906385-113906407 GCCTAGGCCTACACAGGATCAGG - Intronic
960182697 3:114600293-114600315 GGCTGGGTCTACAGATTTACTGG + Intronic
961023889 3:123534775-123534797 GCCTACGTCTACATAGGGACAGG - Intronic
961451337 3:127003643-127003665 GGCTGGGTCTGCAGGGGAACCGG + Intronic
962437249 3:135378512-135378534 GCTTCAGTCTACAGAGTAACTGG - Intergenic
962891291 3:139675481-139675503 GCCTGAGTCTACAAAGACACTGG + Intronic
963875644 3:150471523-150471545 GCCTAGGCCTACACAGGATCAGG + Intergenic
964636535 3:158863745-158863767 GCCTAGGCCTACACAGGATCAGG - Intergenic
967035996 3:185648676-185648698 ACCTGGGTCTACAGACCACCTGG + Intronic
967783268 3:193462843-193462865 GCCTGGATCTTCAGAGTAAATGG - Intronic
968923982 4:3537773-3537795 GCCTGGGTCTACTGACAGACAGG - Intergenic
968936641 4:3614488-3614510 GCCTGGGCCTACAGAGGTGGAGG + Intergenic
970820508 4:20206047-20206069 GCCTGGGCCTACAGAGGGTCAGG + Intergenic
971213496 4:24642188-24642210 GCCTCGGTCTCCAGAAGAGCTGG - Intergenic
972223901 4:36989558-36989580 GCCTCAGTCTCCAGAGTAACTGG - Intergenic
972587102 4:40447894-40447916 GCCTCGGCCTCCAGAGTAACTGG - Intronic
972680038 4:41296556-41296578 GCCTAGGCCTACAGAGGGTCAGG - Intergenic
973193619 4:47414892-47414914 GCCTGGGCCTTCAGACCAACTGG + Intronic
973613452 4:52658399-52658421 CCCTAGGTCTACAGCGGATCAGG + Intronic
973743096 4:53937215-53937237 GCCTCAGTCTACTGAGTAACTGG + Intronic
974282716 4:59820205-59820227 GCCTCGGTCTCCAGAGTAGCTGG + Intergenic
974382732 4:61162071-61162093 GGCTGGGTTTACAGATGAAGGGG + Intergenic
975130274 4:70825815-70825837 GCCTTGGTCTACCGAGTAGCTGG - Intronic
975143298 4:70939826-70939848 GCCTTGGTGTACAGAAGAATTGG + Intronic
975752573 4:77539176-77539198 GCCTTAGTCTACTGAGTAACTGG + Intronic
978403722 4:108358218-108358240 GCCTTGGCCTCCAGAGTAACTGG + Intergenic
979620244 4:122790781-122790803 GCCTGGGCCTACAGACGGACAGG + Intergenic
981202778 4:142001226-142001248 GCCTAGGTCTACACAAGATCAGG + Intergenic
982277300 4:153649537-153649559 GCCTGGGTCTACACAGGGTCAGG + Intergenic
982949997 4:161682570-161682592 GCCTTGGTCTACATAGGAACAGG + Intronic
983445410 4:167844621-167844643 GCCTCAGTCTCCAGAGTAACTGG + Intergenic
984046662 4:174808727-174808749 GCCTGTGCCTACAGAGAATCAGG - Intronic
984771764 4:183442950-183442972 GCCTCGGCCTACAGAGTAGCTGG + Intergenic
1202770180 4_GL000008v2_random:197339-197361 GCCTTGGTCTCCTGAGCAACTGG + Intergenic
985749289 5:1665203-1665225 AACTGGGTCTGCAGAGGAAGAGG + Intergenic
985945222 5:3177150-3177172 GCCTGTGTCTCAAGAGGAAAGGG + Intergenic
986270149 5:6223053-6223075 GGCTGGGTCTTCAGATGAACAGG - Intergenic
986418427 5:7551468-7551490 GCCTGTGTCTACTGAGTTACAGG - Intronic
987711973 5:21512036-21512058 GCCTTGGCCTCCAGAGGAGCTGG - Intergenic
988302436 5:29448747-29448769 GCCTTGGCCTCCAGAGGAGCTGG + Intergenic
988647822 5:33114212-33114234 GCCTAGGCCTACATAGGGACAGG + Intergenic
988942000 5:36156257-36156279 GCCTGGGCCTCCAGTGGAGCCGG + Intronic
991247852 5:64526659-64526681 GCCTGAGGCTACAGATGATCAGG + Intronic
991708118 5:69379707-69379729 GCCTAGGTCTACACAGGATTAGG + Intronic
991762333 5:69931175-69931197 GCCTTGGCCTCCAGAGGAGCTGG - Intergenic
991784992 5:70186930-70186952 GCCTTGGCCTCCAGAGGAGCTGG + Intergenic
991841561 5:70806224-70806246 GCCTTGGCCTCCAGAGGAGCTGG - Intergenic
991877439 5:71187322-71187344 GCCTTGGCCTCCAGAGGAGCTGG + Intergenic
992285763 5:75233799-75233821 GCCTGGGTCTGCTGAGTAGCTGG - Intronic
993169722 5:84402791-84402813 GCCTCAGTCTCCAGAGTAACTGG + Intergenic
994095255 5:95842070-95842092 GCCTGTGTCAGAAGAGGAACAGG - Intergenic
995744749 5:115392016-115392038 GCCTTGCTCCACAGAAGAACAGG + Intergenic
997326040 5:133022282-133022304 GCCTAGGTCTACACAGGGTCAGG + Intronic
997554697 5:134785551-134785573 GTCTGTGTTTACGGAGGAACAGG + Exonic
998067010 5:139167427-139167449 GCCTAGGTCTACACAGGGTCAGG - Intronic
999180811 5:149669457-149669479 GCCTGGGTCTACTGACAGACAGG - Intergenic
999534856 5:152505054-152505076 CCCTGGATCTACAGACCAACTGG - Intergenic
1000310640 5:160041008-160041030 GCCTAGGCCTACACAGGATCAGG + Intronic
1000321081 5:160135005-160135027 GCCTCGGTCTCCAGAGTAGCTGG + Intergenic
1001153791 5:169255402-169255424 GCCTAGGTCTACACAGGGTCAGG - Intronic
1001225272 5:169939268-169939290 GCCTAGGTCTACACAGGGTCAGG + Intronic
1001931519 5:175676477-175676499 GGCTGGGGATACACAGGAACAGG - Intronic
1003015495 6:2464249-2464271 TGCTGGGTCTGCAGAGGAACGGG + Intergenic
1003104252 6:3202397-3202419 GCCTGGGCCTCCCGAGTAACTGG + Intergenic
1003506137 6:6741902-6741924 AGCTGGCTCTACAGAGGAGCAGG + Intergenic
1004408263 6:15355724-15355746 GCCTCGGTCTCCAGAGGAGGTGG + Intronic
1005503280 6:26448645-26448667 GCCTGGGTCTCCTGGGGAATGGG - Intronic
1006583262 6:35088690-35088712 GCCTGGGTCTTCAGAGCTGCAGG - Exonic
1006947006 6:37791367-37791389 CCCTGGGTCTACAGGAGAACAGG - Intergenic
1007169907 6:39855703-39855725 GCCTGGGTCTCCAGAGCAGGAGG - Intronic
1007719437 6:43876472-43876494 GCCTGGGACCACAGAGGACCAGG - Intergenic
1008296179 6:49781193-49781215 GCCTGGGCCTACAGAGGGTCAGG + Intergenic
1008651711 6:53570525-53570547 GCCTGGGCCTCCAGAGTAGCTGG + Intronic
1009005732 6:57784652-57784674 GCCTTGGCCTCCAGAGGAGCTGG + Intergenic
1012529990 6:100223876-100223898 GCCTAGGCCTACACAGGATCAGG - Intergenic
1012974296 6:105763512-105763534 ACCTGGGTCTTCAGGGGAAGTGG - Intergenic
1013295623 6:108756032-108756054 GCCTGGCTACAGAGAGGAACTGG - Intergenic
1013315274 6:108936369-108936391 GCCTGGGCCTCCAGAGTAGCTGG + Intronic
1013818615 6:114129368-114129390 GCCTGGGCCTCCAGAGTAGCTGG + Intronic
1014321149 6:119929642-119929664 GCCTCGGCCTACAGAGGGTCAGG + Intergenic
1014501924 6:122202389-122202411 GCCTAGGTCTACATAGGGTCAGG + Intergenic
1014843977 6:126253199-126253221 GGCTGGGTCTACACAGGGTCAGG + Intergenic
1015608910 6:134992540-134992562 GCCTAGGCCTACACAGGATCAGG - Intronic
1016716777 6:147242122-147242144 GCCTAGGCCTACACAGGATCAGG - Intronic
1019785804 7:2976588-2976610 GCCTCGGCCTCCAGAGTAACTGG - Intronic
1021473528 7:21034047-21034069 GCCTCAGTCTTCAGAGGAGCTGG - Intergenic
1022021425 7:26402768-26402790 GCCTAGGCCTACACAGGATCAGG - Intergenic
1023972421 7:45000628-45000650 ACCTGGGGCTGCAGAGGAAGTGG + Intronic
1026419902 7:70223807-70223829 GCCGAGGACTACACAGGAACAGG - Intronic
1026841115 7:73670340-73670362 ATCTGGGGCTACAGAGGAGCTGG + Intronic
1027980798 7:85219124-85219146 GCCTGGGCATACAGAGGATGTGG - Intergenic
1028073220 7:86478112-86478134 GCCTGGGTATAAAGAGTGACTGG - Intergenic
1030073137 7:105714571-105714593 GCCTGGGTCCCCTGAGGGACAGG + Intronic
1031237625 7:119196992-119197014 GCCTGGGTGTAGAGAGGAGAGGG - Intergenic
1031891958 7:127304827-127304849 GCCTAGGCCTACACAGGATCAGG - Intergenic
1031980740 7:128122714-128122736 GCCGGGGTCTGGAGAGGAACGGG + Intergenic
1032929551 7:136650949-136650971 GCCTAGGTCTACACAGGGTCAGG + Intergenic
1032977854 7:137245765-137245787 GCCTAGGTCTACACAGGGTCAGG - Intronic
1034461751 7:151201384-151201406 GCTTTGGTCTACAGGGGAAGTGG + Intronic
1036917800 8:12821470-12821492 GCCTTGGTCTACTGAAGAACTGG + Intergenic
1037624538 8:20595576-20595598 CCCTGGGTATACAGAGGCAGTGG - Intergenic
1037868864 8:22472411-22472433 GCCTAGGTCTACACAGGGTCAGG + Intronic
1040430208 8:47333080-47333102 GCCTAGGTCTACACAGGGTCAGG + Intronic
1040759492 8:50821812-50821834 GCCTGGGCCTACATAGGGCCAGG + Intergenic
1043219583 8:77642812-77642834 GCCTAGGCCTACATAGGATCAGG - Intergenic
1043253233 8:78102036-78102058 GCCTCAGTCTACCGAGTAACTGG - Intergenic
1046157452 8:110311371-110311393 GCCTGGGCCTACAAAGGGTCAGG + Intergenic
1046341768 8:112868121-112868143 GCCTAGGTCTACACAGGGTCAGG + Intronic
1047371295 8:124258113-124258135 GCCTCAGCCTCCAGAGGAACTGG - Intergenic
1047645293 8:126863777-126863799 ACCTGGGTGTTCAGAGGACCTGG + Intergenic
1048227809 8:132606394-132606416 GCCTAGGTCTACACAGGGTCAGG - Intronic
1048586313 8:135777387-135777409 GCCTGGGTCATCAGTGGCACTGG - Intergenic
1049225381 8:141448260-141448282 GGCTGAGTCTGCAGAGGCACGGG - Intergenic
1049796414 8:144499214-144499236 GCCTGGGGCTCCAGGGGAATGGG + Intronic
1050770584 9:9194106-9194128 GCCTAGGTCTACACAGGGTCAGG + Intronic
1051028633 9:12646810-12646832 GCCTCGGCCTCCAGAGTAACTGG - Intergenic
1051181484 9:14416453-14416475 GCCTGGGCCTACACAGGGTCAGG - Intergenic
1053095731 9:35326636-35326658 GCCTTGGTCTCCCGAGGCACTGG + Intronic
1053577812 9:39370706-39370728 GGCTGGGTATACAGAGGAAAGGG + Intergenic
1053842321 9:42198649-42198671 GGCTGGGTATACAGAGGAAAGGG + Intergenic
1054099388 9:60929423-60929445 GGCTGGGTATACAGAGGAAAGGG + Intergenic
1054120785 9:61205047-61205069 GGCTGGGTATACAGAGGAAAGGG + Intergenic
1060526565 9:124324285-124324307 CTCTGGGTTTCCAGAGGAACAGG + Intronic
1060536776 9:124395969-124395991 GCATGTGTCTCCATAGGAACTGG - Intronic
1061111692 9:128576896-128576918 GCCTGGCTCTGCAGAGGCAGGGG + Exonic
1061164062 9:128912353-128912375 CCCTGGGAACACAGAGGAACAGG + Intronic
1061499397 9:130993466-130993488 CCCTGGGTCCCCAGAGGAAGTGG + Intergenic
1186968752 X:14817013-14817035 CCCTGTGTCTATATAGGAACTGG - Intergenic
1187533699 X:20118256-20118278 GCCTGGGGCTCCATGGGAACGGG - Intergenic
1187997262 X:24941497-24941519 GCCTGGGCCTACAGGGTTACTGG - Intronic
1190150967 X:47947621-47947643 GCCTGGGTCTACACAGGGTCAGG + Intronic
1190748558 X:53341507-53341529 GCCTGGGGTGTCAGAGGAACTGG - Intergenic
1191014744 X:55797053-55797075 GCCTAGGTCTACACAGGATTAGG + Intergenic
1191823525 X:65339294-65339316 GCATGGGTCTACAGTGCACCAGG + Intergenic
1193128846 X:77898475-77898497 GCCTCAGTCTACAGAGTAGCTGG + Intergenic
1194432343 X:93824772-93824794 GCCTAGGCCTACACAGGGACAGG - Intergenic
1194904974 X:99564151-99564173 GCCTAGGCCTACAGAGGGTCAGG + Intergenic
1196218742 X:113087290-113087312 GCATGGAACTACAGAGGAAGAGG + Intergenic