ID: 1108014278

View in Genome Browser
Species Human (GRCh38)
Location 13:46057714-46057736
Sequence GACCAAAACCCTGAGGGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108014273_1108014278 9 Left 1108014273 13:46057682-46057704 CCTCAATGCTAAAATTGGAGGTA 0: 1
1: 0
2: 0
3: 10
4: 203
Right 1108014278 13:46057714-46057736 GACCAAAACCCTGAGGGTTAGGG 0: 1
1: 0
2: 0
3: 16
4: 148
1108014270_1108014278 27 Left 1108014270 13:46057664-46057686 CCAAAAAACAGACTCTCTCCTCA 0: 1
1: 0
2: 0
3: 15
4: 248
Right 1108014278 13:46057714-46057736 GACCAAAACCCTGAGGGTTAGGG 0: 1
1: 0
2: 0
3: 16
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108014278 Original CRISPR GACCAAAACCCTGAGGGTTA GGG Intronic
902365130 1:15968170-15968192 GACCAAAACTCTCACAGTTAAGG + Intronic
902864514 1:19269422-19269444 GACCAGAGCCCTGAGGGATGTGG - Intergenic
902866739 1:19284836-19284858 GACCAGAGCCCTGAGGGATGTGG - Intronic
902869793 1:19307152-19307174 GACCAGAGCCCTGAGGGATGTGG - Intronic
904961460 1:34336469-34336491 GAGCAAAACCCTGAGGAGCAGGG - Intergenic
906131689 1:43462769-43462791 GACCCAAACCCTGGGGCTTTGGG + Intergenic
907787196 1:57624093-57624115 GACAACAAACCTGTGGGTTAGGG - Intronic
908644315 1:66260754-66260776 GACCAAAACCCTCAAGGGTTTGG - Intronic
910761817 1:90740351-90740373 AACCAAAATCCTGAGTATTATGG - Intergenic
913126115 1:115791963-115791985 GACCATAAGCCTGAGTGTAAAGG + Intergenic
913140690 1:115938619-115938641 GACCATCACACTGAGGGCTAGGG - Intergenic
914816569 1:151067396-151067418 GAGAAAAACCCTGAAGGTGATGG + Exonic
914945586 1:152062716-152062738 GCCCCAAATCCTGAGGTTTAGGG + Intergenic
915641267 1:157228787-157228809 GAATAGAACCCTGAGGATTAAGG - Intergenic
918423019 1:184383317-184383339 TACCAACACATTGAGGGTTAGGG + Intergenic
919216103 1:194557136-194557158 GACCAAAATCCTGAAGATAAAGG - Intergenic
919239376 1:194891895-194891917 GACCAAATCCCTGAGTGTTTCGG - Intergenic
920041960 1:203103891-203103913 GACCATCACACTGGGGGTTAGGG - Intronic
920046659 1:203137173-203137195 GACCAAAACCCTGGAGGTGAGGG + Intronic
923721152 1:236468124-236468146 CACCAAAACCCTGGGGGCTGGGG - Intronic
923953465 1:238988047-238988069 TACCAAAACCCAGAGGGACAAGG + Intergenic
924197183 1:241620373-241620395 TACCATCACTCTGAGGGTTAGGG - Intronic
1067063425 10:43089857-43089879 GACAAGAACCCTGAGAGTTAAGG + Intronic
1069865556 10:71500667-71500689 GATAAAAACCATGAGGGTTGTGG + Intronic
1070249813 10:74764080-74764102 GAGCAAAGCCCTGAGGGTGGGGG + Intergenic
1070642438 10:78179480-78179502 GACCAAGACCCTCAGGGGCAAGG + Intergenic
1073550458 10:104395703-104395725 AACCAAAACCCTGAGGGAAAGGG + Intronic
1073725439 10:106224847-106224869 CACCAAATGCCTGAGGGTGAGGG - Intergenic
1074106244 10:110391822-110391844 GACCAAAACCCCGGGGGATGAGG - Intergenic
1074261664 10:111859921-111859943 GACCATATCCCTGAGGTTTGGGG + Intergenic
1074976786 10:118587533-118587555 GACCAAAACCATCTGGGTGAGGG - Intergenic
1076214905 10:128685777-128685799 GAGCACAACCCTGAGGATGAGGG - Intergenic
1078906292 11:15691098-15691120 GAGCAAAACCCTGAGGGGCAAGG + Intergenic
1080743907 11:35090669-35090691 GATGAAGACCCTGAGGCTTATGG - Intergenic
1081600263 11:44488026-44488048 TGCCAAAACCCTGAGGCTCAAGG - Intergenic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1096535246 12:52268019-52268041 GATGAAAAACCTGAGGCTTAGGG + Intronic
1099586393 12:84522255-84522277 GACAAAAAGGCTGAGGGTTAAGG + Intergenic
1103868363 12:124072278-124072300 GCTCAAAACCATGAGGGTCAAGG - Intronic
1108014278 13:46057714-46057736 GACCAAAACCCTGAGGGTTAGGG + Intronic
1110706562 13:78605901-78605923 GACCAGAAACATGAGGGCTATGG + Intergenic
1112428115 13:99323476-99323498 GACCAAAGCCATGAGGGTGATGG + Intronic
1118111253 14:62722394-62722416 GAAAAAAAACCTGAGGCTTAGGG + Intronic
1121224169 14:92309114-92309136 CACAAAAACCCTGAGAGGTAAGG + Intergenic
1122676065 14:103414606-103414628 GAAGAAAACCCAGAGGGTTGTGG + Intronic
1127234326 15:57031910-57031932 AACCAAAACTCTGAGGGGGAGGG + Intronic
1127375634 15:58382076-58382098 GCCAAAAATCCTGAGGGTGATGG + Intronic
1127907682 15:63388608-63388630 GACCAAATCCCTGAGGCTAGAGG - Intergenic
1128546716 15:68573422-68573444 GAGCAAAACCATGAAGGTCAAGG + Intergenic
1131236610 15:90702402-90702424 TACCATCACCCTGAGGGTTAGGG - Intergenic
1132010056 15:98267693-98267715 GACCACCACCCTGCTGGTTATGG + Intergenic
1132723204 16:1327125-1327147 GAACAAAGCCCTGGGGGGTAGGG - Intergenic
1141875869 16:86824061-86824083 GGCAATAACCCTGATGGTTACGG + Intergenic
1142432202 16:90035542-90035564 GACCAAAACCATGAGGAACAGGG + Intronic
1144853086 17:18253967-18253989 GACCAATACCCAGAGGGAAAAGG - Intronic
1149343177 17:55707615-55707637 GACAAAGACCTTGAGGTTTAAGG + Intergenic
1156024114 18:32631833-32631855 GTCCAAAAGCCTGAGAGTCAGGG + Intergenic
1158587839 18:58756629-58756651 AACCATAACCATGAGTGTTATGG + Intergenic
1158587948 18:58757270-58757292 AACCATAACCATGAGTGTTATGG - Intergenic
1165141824 19:33704332-33704354 GACCCAGACCCTGAGGGCAAAGG - Intronic
1166308614 19:41949621-41949643 GACCAAAGCCCTGGGGGTCAGGG - Intergenic
1167216332 19:48167969-48167991 CACCAAAATCCTGAGGGCAAAGG + Intronic
925703965 2:6666669-6666691 TACCAACACCTTGGGGGTTAGGG - Intergenic
928403987 2:31000189-31000211 GACCAGAACACTCAGGGTTTAGG - Intronic
933164581 2:79062147-79062169 GAACAAAACTCTGAGGATCAAGG - Intergenic
933321832 2:80785462-80785484 GAGCTAAGCCTTGAGGGTTATGG + Intergenic
933424041 2:82087293-82087315 GACCAAAATACTGAGTGATATGG - Intergenic
934690296 2:96353534-96353556 GACAAAAACCCTGAGGGAGGAGG + Intronic
937616882 2:123934803-123934825 GAGCAAAGCCTTGAGAGTTATGG - Intergenic
937985235 2:127635357-127635379 GACCAAGCCCCTGAGGGCTCTGG + Intronic
938555310 2:132418126-132418148 GACCAGAACCCAGAAGGTTTGGG + Intronic
939562002 2:143743216-143743238 GACGAAAAACCTGAGGCTCAGGG - Intronic
941223498 2:162814957-162814979 AAACAAAACCCTGAGGTGTAAGG - Intronic
944948413 2:204717720-204717742 GACAAAGAACCTGAGGGTGATGG + Intronic
947453856 2:230235060-230235082 TACCAAATCCCTGAAGGTAAAGG + Intronic
1168781985 20:500385-500407 TAGCACAACCCTGAGGGTAAAGG + Intronic
1170776711 20:19380987-19381009 GACCAACAGCCTAAGGGTCAGGG + Intronic
1170997410 20:21376579-21376601 AACCACAACTCTGTGGGTTAAGG + Intronic
1172235216 20:33368197-33368219 GACCTAATTCCTAAGGGTTAAGG - Intronic
1173325231 20:42026942-42026964 GAACATAACCCTGAGGGATATGG - Intergenic
1174816163 20:53689032-53689054 GAAGAAAACCAAGAGGGTTAAGG + Intergenic
1178631468 21:34264972-34264994 GACCATTACACTGAGAGTTAGGG - Intergenic
1179596740 21:42447749-42447771 GACCACAAACCTGGGGGTCATGG + Intergenic
1180390275 22:12224631-12224653 GACCAAGACACAGAGAGTTAAGG + Intergenic
1180415660 22:12709836-12709858 GACCAAGACACAGAGAGTTAAGG - Intergenic
1180801412 22:18633838-18633860 GACCAAAGCCCTGGGGGTTCCGG - Intergenic
1180852646 22:19029378-19029400 GACCAAAGCCCTGGGGGTTCCGG - Intergenic
1181220309 22:21361423-21361445 GACCAAAGCCCTGGGGGTTCCGG + Intergenic
1181583756 22:23841978-23842000 GACCAAGACACTGAGGGGTTGGG + Intergenic
951357985 3:21692201-21692223 GATGAAGACCCTGAGGTTTAGGG + Intronic
953709861 3:45260802-45260824 GACCAAAGCCATGAGGGGTGGGG - Intergenic
954258230 3:49420791-49420813 GACAAAAAGCCTGAGGTTGAGGG + Intronic
958960633 3:100506170-100506192 TACCAATACCCTGTGGATTATGG - Intronic
959162149 3:102736392-102736414 GAGCAAAACCTGGAGGGTGAAGG + Intergenic
962300968 3:134242946-134242968 CACCAAAACGCCTAGGGTTAAGG + Intronic
962403402 3:135080369-135080391 AACCAAAACTCTTATGGTTAAGG + Intronic
963117507 3:141743415-141743437 GTCAAAAGCCCTAAGGGTTAGGG - Intronic
964855057 3:161137862-161137884 AACCATAACACTGAGGGTTAGGG + Intronic
966188604 3:177250240-177250262 GACCATAACCCTGAGAGAAAGGG + Intergenic
970005771 4:11409365-11409387 TACCATCACACTGAGGGTTAGGG - Intronic
970856349 4:20652934-20652956 GACCAAAATGCTGAGTGATACGG - Intergenic
971091302 4:23348816-23348838 CACCATCACCATGAGGGTTATGG + Intergenic
971489241 4:27193452-27193474 GATGAAGACACTGAGGGTTAGGG + Intergenic
974885254 4:67809869-67809891 GACCAGAACCCTTAGAGGTAGGG + Intergenic
982864500 4:160493190-160493212 GTCTACAACCCTGAGGATTAAGG + Intergenic
986636383 5:9825968-9825990 GGCCAAAATCCAGTGGGTTAGGG + Intergenic
987078674 5:14406850-14406872 GACCTGAACCCTGAGGATTCAGG + Intronic
987596559 5:20008632-20008654 AACTAAAACCCTAAGGGTCATGG - Intronic
987636904 5:20555048-20555070 TGCCAAAACACTGGGGGTTACGG - Intronic
989011161 5:36875333-36875355 GAGCAAAATCCTGAAGGTGAAGG + Intergenic
990369704 5:55104962-55104984 GACCAAAGGACTGAGGGGTAGGG + Intronic
997454621 5:134007515-134007537 CACCACAACCCTGAGGGAGAGGG + Intergenic
998129358 5:139643524-139643546 GACCCAAAGCCTGAAGGCTAGGG - Intergenic
999643648 5:153697095-153697117 GACCAAAACCTTTCAGGTTAGGG - Intronic
1001949024 5:175803152-175803174 GACAATAACACTGTGGGTTAGGG + Intronic
1003136756 6:3440081-3440103 GACCAAAACACTGGGATTTAGGG + Intronic
1007269509 6:40625684-40625706 TTCCACATCCCTGAGGGTTATGG + Intergenic
1008211741 6:48732892-48732914 AACAAAAACCCTGAGAGATATGG - Intergenic
1008789562 6:55213895-55213917 GAAAAAAACCTTGAGAGTTAAGG - Intronic
1011666490 6:89639460-89639482 AAGCAAAAGCCTGAGGCTTAGGG - Intergenic
1013313958 6:108923786-108923808 GCCTAAAACCCTGAGGGAGAAGG - Intronic
1015519169 6:134114388-134114410 AACCAGAACCCTGTGGGGTAGGG + Intergenic
1019275587 7:173844-173866 CAACAAGACCCTTAGGGTTAGGG + Intergenic
1022009786 7:26298971-26298993 TACCAACACACTGGGGGTTAGGG + Intronic
1022412576 7:30150503-30150525 GGCCAAAGCGCTCAGGGTTATGG + Intronic
1022993587 7:35731749-35731771 GACCAAGAGCCTGAGTGATAAGG + Intergenic
1026969181 7:74457606-74457628 GAGCAAAGCCCCCAGGGTTAAGG - Intronic
1028655379 7:93199529-93199551 AATCAAAACCCTGAGAGTCAAGG - Intronic
1030203484 7:106929310-106929332 GATAAAAACCCTGGGTGTTAAGG - Intergenic
1035144971 7:156805789-156805811 GACCATCACACTGAGGATTAGGG - Intronic
1035529855 8:342740-342762 GATCAAAGCCCTGAGGGATTCGG + Intergenic
1036141090 8:6209085-6209107 CAACAAAACCATGAGGCTTATGG + Intergenic
1036766229 8:11550783-11550805 GAGAAAACCCCTGAGGGTGATGG - Intronic
1037830911 8:22188484-22188506 GACAAAAACACTGAGCCTTAAGG + Intronic
1038919773 8:32069740-32069762 TACCAAAACCTTGAGGGTGTTGG + Intronic
1039155678 8:34554122-34554144 TACCAAAATCCTCAGGGGTAGGG + Intergenic
1043397539 8:79853598-79853620 GACATAAACACAGAGGGTTATGG - Intergenic
1044428287 8:92079895-92079917 GAACTAAAGCCTGAGGGTTGAGG - Intronic
1044875395 8:96660425-96660447 GTCCAAAGCCCTGGGGGTTAGGG + Intronic
1046830875 8:118744458-118744480 AACCAAAACCATCAGGGTCATGG - Intergenic
1047356098 8:124123614-124123636 GACCCAAACCCTTAAGGATATGG - Intergenic
1047775312 8:128065568-128065590 GCCCTGAACCCTGAGGGTAAGGG + Intergenic
1048150191 8:131886266-131886288 TACCATAACCTTGGGGGTTAGGG + Intergenic
1048962792 8:139594323-139594345 GACCAAAGCCCAGAGGGAAAGGG - Intergenic
1050276495 9:4006644-4006666 GATGAAAACACTGAGGTTTAGGG + Intronic
1050669770 9:7982797-7982819 GACCCAAAACCTGAGGATAAAGG + Intergenic
1051730506 9:20138014-20138036 GTCCACAGCCCTGAGAGTTAAGG + Intergenic
1053276730 9:36788760-36788782 GACGACAAGCCTGAGGGTTGGGG - Intergenic
1053461344 9:38273667-38273689 CACCATCACACTGAGGGTTAGGG - Intergenic
1056577041 9:87863377-87863399 GACAGAAAACCTGAGGGTCAAGG - Intergenic
1059890750 9:118799566-118799588 GACTTAAACCCTGAGTTTTAAGG + Intergenic
1060969564 9:127730456-127730478 GACCCAGACCCTGAGGGGTGGGG - Intronic
1061555662 9:131367044-131367066 GGGCAAAACACTGAGGGGTAGGG - Intergenic
1062383773 9:136300110-136300132 GACAAAGACACTGAGGGTCAGGG - Intronic
1062590825 9:137273844-137273866 CACCAAAGCCCCGAGGGTGAGGG - Intergenic
1189530571 X:41877532-41877554 GATCAAAGCCCAGAGGGTGAGGG + Intronic
1191678055 X:63812187-63812209 GACAATAACCCTGAGAGTCAGGG - Intergenic
1192334881 X:70210193-70210215 GACCAAAATGCTGAGTGATATGG + Intergenic
1195379084 X:104254427-104254449 GACCAAGACCGTGAGGGTGGCGG - Exonic
1195700456 X:107701590-107701612 GAGCACATCCCTGAGGGTTGGGG - Intergenic
1196908081 X:120458509-120458531 GAGAAACACCCTGAGGGTTCTGG + Intronic
1196977971 X:121180730-121180752 GAGCAGAACCCTGGGGGTTAAGG - Intergenic
1198965005 X:142218046-142218068 CACCAAAAACCACAGGGTTAGGG - Intergenic
1199185560 X:144911284-144911306 GACCAAAATGCTGAGTGATATGG - Intergenic
1201629370 Y:16052750-16052772 CACCATCACCCTGAGAGTTAGGG - Intergenic