ID: 1108014547

View in Genome Browser
Species Human (GRCh38)
Location 13:46060819-46060841
Sequence AAATTAACATGACTGCTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 254}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108014547_1108014550 7 Left 1108014547 13:46060819-46060841 CCATTAAGCAGTCATGTTAATTT 0: 1
1: 0
2: 1
3: 17
4: 254
Right 1108014550 13:46060849-46060871 TACTTCATCGTCTCAGCCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 105
1108014547_1108014554 25 Left 1108014547 13:46060819-46060841 CCATTAAGCAGTCATGTTAATTT 0: 1
1: 0
2: 1
3: 17
4: 254
Right 1108014554 13:46060867-46060889 TCAGGGGCCTCATCTGTACCAGG 0: 1
1: 0
2: 0
3: 42
4: 304
1108014547_1108014552 9 Left 1108014547 13:46060819-46060841 CCATTAAGCAGTCATGTTAATTT 0: 1
1: 0
2: 1
3: 17
4: 254
Right 1108014552 13:46060851-46060873 CTTCATCGTCTCAGCCTCAGGGG 0: 1
1: 0
2: 0
3: 6
4: 165
1108014547_1108014555 29 Left 1108014547 13:46060819-46060841 CCATTAAGCAGTCATGTTAATTT 0: 1
1: 0
2: 1
3: 17
4: 254
Right 1108014555 13:46060871-46060893 GGGCCTCATCTGTACCAGGAAGG 0: 1
1: 0
2: 2
3: 25
4: 228
1108014547_1108014551 8 Left 1108014547 13:46060819-46060841 CCATTAAGCAGTCATGTTAATTT 0: 1
1: 0
2: 1
3: 17
4: 254
Right 1108014551 13:46060850-46060872 ACTTCATCGTCTCAGCCTCAGGG 0: 1
1: 0
2: 0
3: 17
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108014547 Original CRISPR AAATTAACATGACTGCTTAA TGG (reversed) Intronic