ID: 1108014550 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:46060849-46060871 |
| Sequence | TACTTCATCGTCTCAGCCTC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 110 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 105} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1108014547_1108014550 | 7 | Left | 1108014547 | 13:46060819-46060841 | CCATTAAGCAGTCATGTTAATTT | 0: 1 1: 0 2: 1 3: 17 4: 254 |
||
| Right | 1108014550 | 13:46060849-46060871 | TACTTCATCGTCTCAGCCTCAGG | 0: 1 1: 0 2: 0 3: 4 4: 105 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1108014550 | Original CRISPR | TACTTCATCGTCTCAGCCTC AGG | Intronic | ||