ID: 1108014551

View in Genome Browser
Species Human (GRCh38)
Location 13:46060850-46060872
Sequence ACTTCATCGTCTCAGCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108014547_1108014551 8 Left 1108014547 13:46060819-46060841 CCATTAAGCAGTCATGTTAATTT 0: 1
1: 0
2: 1
3: 17
4: 254
Right 1108014551 13:46060850-46060872 ACTTCATCGTCTCAGCCTCAGGG 0: 1
1: 0
2: 0
3: 17
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108014551 Original CRISPR ACTTCATCGTCTCAGCCTCA GGG Intronic