ID: 1108014628

View in Genome Browser
Species Human (GRCh38)
Location 13:46061630-46061652
Sequence CTCTGCTGGTACCTTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4280
Summary {0: 1, 1: 13, 2: 196, 3: 1124, 4: 2946}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108014625_1108014628 -7 Left 1108014625 13:46061614-46061636 CCTCAGGAAGACCTCACTCTGCT 0: 1
1: 0
2: 0
3: 22
4: 275
Right 1108014628 13:46061630-46061652 CTCTGCTGGTACCTTGATTTTGG 0: 1
1: 13
2: 196
3: 1124
4: 2946
1108014624_1108014628 6 Left 1108014624 13:46061601-46061623 CCAATGAGAGAATCCTCAGGAAG 0: 1
1: 0
2: 1
3: 26
4: 415
Right 1108014628 13:46061630-46061652 CTCTGCTGGTACCTTGATTTTGG 0: 1
1: 13
2: 196
3: 1124
4: 2946
1108014622_1108014628 17 Left 1108014622 13:46061590-46061612 CCATCTACAAGCCAATGAGAGAA 0: 1
1: 25
2: 280
3: 811
4: 1567
Right 1108014628 13:46061630-46061652 CTCTGCTGGTACCTTGATTTTGG 0: 1
1: 13
2: 196
3: 1124
4: 2946

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108014628 Original CRISPR CTCTGCTGGTACCTTGATTT TGG Intronic
Too many off-targets to display for this crispr