ID: 1108019644

View in Genome Browser
Species Human (GRCh38)
Location 13:46113897-46113919
Sequence CAGGATTTTGAGATCAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108019644_1108019655 27 Left 1108019644 13:46113897-46113919 CCCAGTCTGATCTCAAAATCCTG No data
Right 1108019655 13:46113947-46113969 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031
1108019644_1108019651 18 Left 1108019644 13:46113897-46113919 CCCAGTCTGATCTCAAAATCCTG No data
Right 1108019651 13:46113938-46113960 GCCTTGGCCTCCCAAAGTGCTGG 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
1108019644_1108019653 19 Left 1108019644 13:46113897-46113919 CCCAGTCTGATCTCAAAATCCTG No data
Right 1108019653 13:46113939-46113961 CCTTGGCCTCCCAAAGTGCTGGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
1108019644_1108019649 2 Left 1108019644 13:46113897-46113919 CCCAGTCTGATCTCAAAATCCTG No data
Right 1108019649 13:46113922-46113944 CTCAAGCAATCTTCCTGCCTTGG 0: 289
1: 4017
2: 11649
3: 31933
4: 62439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108019644 Original CRISPR CAGGATTTTGAGATCAGACT GGG (reversed) Intergenic
No off target data available for this crispr