ID: 1108020424

View in Genome Browser
Species Human (GRCh38)
Location 13:46122308-46122330
Sequence ATGCTGTCCTAGAAGAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108020424_1108020425 1 Left 1108020424 13:46122308-46122330 CCTTTATTCTTCTAGGACAGCAT 0: 1
1: 0
2: 1
3: 23
4: 192
Right 1108020425 13:46122332-46122354 TCTCAAACTTTAATGTGCGTAGG 0: 1
1: 7
2: 41
3: 128
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108020424 Original CRISPR ATGCTGTCCTAGAAGAATAA AGG (reversed) Intergenic
901952131 1:12757807-12757829 AAGCTGTCCTAGGAGAAGGAGGG - Intronic
902194894 1:14791182-14791204 AGGCTGTCCCAGCAGATTAAGGG - Intronic
902886855 1:19411458-19411480 GAGCTGTCCTAGAACAGTAATGG - Intronic
904837439 1:33348576-33348598 GGGCTGTCCTAGAAAAATCAGGG + Intronic
905547758 1:38813332-38813354 ATGCCGTCCTAGCTGAATATTGG - Intergenic
907060113 1:51413754-51413776 ATCCTGTCTTAAAAAAATAAAGG - Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908693626 1:66811297-66811319 ATGCTTTTATAGAAGAAAAATGG + Intergenic
908704844 1:66941645-66941667 AGGCTGAACTGGAAGAATAATGG + Intronic
910997447 1:93122235-93122257 ATGAAGTGCTAAAAGAATAATGG - Intronic
913574487 1:120157190-120157212 ATGCTGTCAAAGAGGAAAAAAGG + Exonic
914295756 1:146321994-146322016 ATGCTGTCAAAGAGGAAAAAAGG + Intergenic
914556795 1:148772792-148772814 ATGCTGTCAAAGAGGAAAAAAGG + Intergenic
914616039 1:149357438-149357460 ATGCTGTCAAAGAGGAAAAAAGG - Intergenic
914956308 1:152165729-152165751 ATCGTGTCCTTTAAGAATAAAGG + Intergenic
914980080 1:152407553-152407575 ATGCTGGCTTATAAGCATAAAGG - Intergenic
917477003 1:175377565-175377587 ATGCTGACCAAGCAGATTAACGG - Intronic
920580415 1:207101679-207101701 ATCCTTTCCCACAAGAATAAAGG - Intergenic
920946186 1:210530735-210530757 ATGCTGTCTTAGAAGCACATAGG - Intronic
922151591 1:223010151-223010173 ATGCTTTCCTAAAAAAATTAAGG + Intergenic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1063613654 10:7584208-7584230 ATGCAGTTCAAGAAAAATAAAGG + Intronic
1064932036 10:20639125-20639147 TTGCTGTCCAAGGACAATAAGGG + Intergenic
1066528579 10:36310163-36310185 ATGCTGCCCTAGCAGAATGATGG + Intergenic
1067121999 10:43480935-43480957 ATGATATTCTAGATGAATAAAGG + Intronic
1068220975 10:54045035-54045057 GTGCTGACCTAGTAGAATACTGG + Intronic
1068633662 10:59324387-59324409 ATGATGTCATGGAAGAATATTGG + Intronic
1071057314 10:81527034-81527056 ATGATGTCCAAGAAGAAAAGGGG + Intergenic
1073197015 10:101699953-101699975 ATGCTATTATAGAGGAATAATGG - Intergenic
1074646090 10:115454344-115454366 ATTCTGACCAAGAAGAAAAAAGG - Intronic
1074890586 10:117733375-117733397 ATTCTCACCTAGCAGAATAAAGG + Intergenic
1076041878 10:127257021-127257043 ATGTTTTCCTAGAAGCAGAAAGG + Intronic
1077094903 11:795162-795184 CTTCTGTCCTAGAAGGATGAGGG + Exonic
1078293459 11:10040548-10040570 ATCCTGTACTGGAAGAAAAAAGG + Intronic
1078969011 11:16384363-16384385 ATGACATCCTAGAAGAATAAAGG + Intronic
1080040174 11:27751826-27751848 ATGCTGTCCTCAGAGTATAATGG + Intergenic
1086371408 11:86158917-86158939 AGGCTTTCCTGGAAAAATAAGGG + Intergenic
1091416830 12:295217-295239 CTGGTGTCCTACAAGAAGAAAGG + Intronic
1094090844 12:26647408-26647430 ATGCTGTTGTAAAAGAAAAAAGG + Intronic
1095034030 12:37334592-37334614 ATGCTGTGCTATAAAAAGAAAGG + Intergenic
1095034318 12:37340290-37340312 ATGCTGTGCTATAAAAAGAAAGG + Intergenic
1095591970 12:43913750-43913772 ATGCTTTAATAAAAGAATAAAGG + Intronic
1099052729 12:77800879-77800901 AGAGTGTCCTAGATGAATAAAGG - Intergenic
1099439606 12:82685343-82685365 ATGGTGTCCTAGAACACTGAAGG - Intergenic
1099631511 12:85152278-85152300 AGGCTGCCTTAGAAGAAGAATGG + Exonic
1099734748 12:86552322-86552344 GTGATTTCCTAGAAGTATAAAGG + Intronic
1101011160 12:100451003-100451025 ATGCTGTGGAAGAAGAATAAGGG + Intergenic
1102601644 12:114035939-114035961 ATCCTGTCCTAAAAGACTACAGG + Intergenic
1106750516 13:32760694-32760716 AAGCTCTCCTGGAAGAATAAAGG + Exonic
1108020424 13:46122308-46122330 ATGCTGTCCTAGAAGAATAAAGG - Intergenic
1108766539 13:53637540-53637562 AGGCTGTACTGGAAGAATAAGGG + Intergenic
1110103023 13:71633526-71633548 AAGCTGTCATAGAAAAATAAAGG - Intronic
1110385865 13:74909910-74909932 ATGCTATACTAAAAGTATAAAGG - Intergenic
1110675113 13:78233318-78233340 ATGCTGTTCTAGATGGATATGGG - Intergenic
1111413538 13:87909705-87909727 ATGATGTCCTTAAAGAAAAAGGG + Intergenic
1111432846 13:88165481-88165503 ATACTGTGTTAGAAAAATAATGG + Intergenic
1111907305 13:94270408-94270430 ATGCTTTCATAGAATAATGAGGG + Intronic
1112299580 13:98217899-98217921 GTGCTGTCCTAGCATAACAAGGG + Intronic
1113847042 13:113398164-113398186 ATCTTCTCCTAGAAGAACAAAGG - Intergenic
1114737415 14:25056841-25056863 CTTGTGTCCTAGCAGAATAAGGG - Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116598862 14:46892396-46892418 ATACAATCCTAGAAGAAAAAGGG + Intronic
1118520214 14:66575167-66575189 AAGCTGTCCTTCAGGAATAAAGG - Intronic
1120534241 14:85673318-85673340 ATGTTTTCTTAGAATAATAATGG + Intergenic
1126146745 15:45481369-45481391 ATGCTGCCTTAGAAACATAATGG - Exonic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1126891091 15:53205076-53205098 GTGATTTTCTAGAAGAATAATGG + Intergenic
1127709088 15:61577888-61577910 AGGCTGTCCTAGAAGATTCTTGG + Intergenic
1127880100 15:63149669-63149691 ATTCTGTGGTAGCAGAATAATGG + Exonic
1128552906 15:68609684-68609706 AGGATGTCCTGGAAGAAGAATGG - Intronic
1131018709 15:89079778-89079800 ATGCTGAGCTAGAAGAAGGAGGG - Intergenic
1131134744 15:89925590-89925612 ATGCTGTCAAAGAATATTAATGG + Intergenic
1133645747 16:7763010-7763032 ATGCTCTACTAGAAGACAAAAGG - Intergenic
1139701518 16:68710835-68710857 ATTCTGTCTCAGAAGAAAAAAGG + Intronic
1141404575 16:83780919-83780941 CTGCTGTCATAAAAGACTAAAGG + Intronic
1141789030 16:86220534-86220556 ATGGTGTCTTAGAAGAATTTGGG - Intergenic
1143600111 17:7939640-7939662 GGGCTGCCCTAGAAGAAGAACGG + Exonic
1144031257 17:11325300-11325322 ATGCAGTCCTAGAAAAGTATTGG - Intronic
1149744251 17:59079679-59079701 ATTCAGTCTTTGAAGAATAAGGG - Intronic
1150037562 17:61820467-61820489 TTGCTGTCCTGTAAGAATACAGG - Intronic
1152504079 17:80735700-80735722 GTGCTGTCCCAGCAGAAGAAAGG - Intronic
1153818312 18:8810036-8810058 ATGCTGTCCCAGAAGCCAAAGGG + Intronic
1155913216 18:31529018-31529040 AAGCTGTCCAAAAAGGATAAAGG + Intronic
1158947632 18:62461008-62461030 AGGCTGTCCTTGAAGCATAAAGG + Intergenic
1159114430 18:64097833-64097855 ATGCTCTCAATGAAGAATAAAGG - Intergenic
1161729952 19:5953531-5953553 AGGTTGTACTAGCAGAATAATGG - Intronic
1162909346 19:13841033-13841055 ATTCTGTCCTCCATGAATAACGG - Intergenic
1164228710 19:23269075-23269097 ATGCTGTCAGAGAAGAGAAATGG - Intergenic
1165173182 19:33907231-33907253 ATGCTGATCTAGAAGTACAATGG + Intergenic
1166576059 19:43839184-43839206 AAACTGTCCTTTAAGAATAAAGG - Intronic
925384657 2:3453627-3453649 TTTGTGTCCCAGAAGAATAAAGG - Intronic
926529540 2:14026260-14026282 AAACTGTCCTATAATAATAAAGG + Intergenic
926875586 2:17473974-17473996 TCACTTTCCTAGAAGAATAAAGG - Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929131850 2:38582932-38582954 ATGATGACCTAAAAGAATTAAGG - Intronic
929926076 2:46210914-46210936 TTGGAGTCCTAGAAGAAGAAGGG - Intergenic
932058959 2:68475484-68475506 ATGCTTTCCCATAAGAATAATGG - Intronic
933448313 2:82411702-82411724 ATGGTTTCCTGGAGGAATAACGG + Intergenic
934055710 2:88249926-88249948 ATGCTTTCCTAGAAAAATAAAGG + Intergenic
935757224 2:106285480-106285502 AAGCTGTCCTTCAAGTATAAAGG + Intergenic
937246204 2:120495617-120495639 ATCCTTTCCTAAAAAAATAATGG + Intergenic
938700465 2:133873566-133873588 ATGCTTTCCTTAAAGAATCAAGG - Intergenic
940545038 2:155072284-155072306 ATTCTGTCATAGCAGCATAAAGG + Intergenic
940898661 2:159105889-159105911 ATATTGTCCTAGTAGAATAAAGG - Intronic
941469272 2:165864224-165864246 ATGCTTTCATAGAAGAGAAAAGG + Intronic
942395503 2:175543301-175543323 ATGCTGTATTAATAGAATAAAGG - Intergenic
942825241 2:180167886-180167908 ATGCAGTCCTGGAAAAAGAATGG + Intergenic
943196196 2:184753315-184753337 ATGTTGTCCTAGAATGACAAAGG + Intronic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944121566 2:196246166-196246188 CTGCTCTCCTAGATGAATGAGGG + Intronic
944183380 2:196921559-196921581 CTACTGTACTAAAAGAATAATGG - Intronic
944819163 2:203411877-203411899 ATGCTTCCCTAGAAGACTCAAGG - Intronic
946603992 2:221382700-221382722 ATGCTGTACAGGAACAATAAAGG + Intergenic
1168916709 20:1494400-1494422 ATTCTCTCCTAGAATAATGATGG - Intergenic
1170383549 20:15789435-15789457 TTGCTGTCATATAAGAAAAATGG - Intronic
1170631562 20:18070887-18070909 ATGCTGTCCTAGGACACCAATGG - Intergenic
1173036007 20:39411192-39411214 ATGAAGTCCTAGAAGGTTAATGG + Intergenic
1173544904 20:43888644-43888666 ATGCAGTGATAAAAGAATAAGGG - Intergenic
1176013455 20:62913446-62913468 ATGCTGACCTCAAAGATTAAGGG + Intronic
1177300814 21:19243858-19243880 ATGCAGCCTTAGAAGAATAAAGG - Intergenic
1177747498 21:25236781-25236803 AAACTTTCCTAGAAGAATGAAGG + Intergenic
1182970448 22:34569393-34569415 ATGGTGTCCTAGATGAATCCCGG - Intergenic
1185235337 22:49709201-49709223 ATGCTTTCCCAGGGGAATAAAGG + Intergenic
949521415 3:4858021-4858043 ATGCTGTTCTAGAAGAAAACAGG - Intronic
953401057 3:42617710-42617732 ATATTTTCCTGGAAGAATAATGG + Intronic
955623370 3:60890333-60890355 ATGCTGCCCTGGAAGATCAACGG - Intronic
956017718 3:64901620-64901642 GTGATGTCCTAGAACAATCAAGG - Intergenic
957427895 3:80063887-80063909 GTTCTGTCCTAGAAGGATTATGG - Intergenic
957934814 3:86928612-86928634 ATGCTGTCCTGTATGTATAATGG + Intergenic
959289702 3:104458171-104458193 TTGCTGTCCTAATAGAACAATGG - Intergenic
960433211 3:117595165-117595187 ATGGTTTCCTAGAAAATTAAAGG - Intergenic
961589737 3:127968817-127968839 ATGCCGTATTAGTAGAATAAAGG + Intronic
962107182 3:132402962-132402984 CTACAGTCCTAGGAGAATAATGG + Intergenic
962293975 3:134163603-134163625 ATGCTGCACTAAAAGAAAAAAGG - Intronic
962942855 3:140141512-140141534 AGCCTGTCTTAGGAGAATAATGG + Intronic
963397493 3:144752201-144752223 ATCTTTTCCTAGAATAATAAAGG + Intergenic
964653931 3:159045133-159045155 TTGCTGTCTTAGAAGATTAAGGG - Intronic
966451621 3:180069777-180069799 AGGCTGTCCTAGAATACTCATGG + Intergenic
966921072 3:184611728-184611750 ATTCTGTCCTAGAAGGAAATTGG + Intronic
971512209 4:27440746-27440768 GTGCTCACCTAGAAGAAAAATGG - Intergenic
972769667 4:42185388-42185410 AGGCTGTCCAGGAAGCATAATGG - Intergenic
974178191 4:58351717-58351739 AAGCTTTCCTTGAAGAATAAAGG - Intergenic
974300154 4:60053867-60053889 ATGCTGTCCTATGAAAATGAAGG + Intergenic
976108941 4:81649670-81649692 ATGTTGTCAGAGAAGGATAATGG - Intronic
976663205 4:87561942-87561964 CTGCTGTCATAGAAGTTTAAGGG - Intergenic
979703175 4:123690356-123690378 AGGCTGTACTAGAAGCATAGTGG + Intergenic
981038892 4:140202686-140202708 ATGATGTCATAAAATAATAAAGG - Intergenic
981162364 4:141513844-141513866 ATGGGATCATAGAAGAATAATGG + Intergenic
983752546 4:171294198-171294220 AAGCTGCCATGGAAGAATAATGG - Intergenic
983864091 4:172742767-172742789 ATGATGTCCTAGAAAAATGGTGG - Intronic
984070755 4:175109145-175109167 ATGTTGTCTGAGAAGAAAAAAGG + Intergenic
986098800 5:4586415-4586437 ATGCTGTCCTGGAATGATAAAGG - Intergenic
987719009 5:21610938-21610960 ATGCTGTCTTCGAAAAACAAGGG - Intergenic
988631725 5:32938522-32938544 CTGCTGTCCTAGAAGGAGATGGG + Intergenic
989539542 5:42603084-42603106 ATCCTGTCCTTCAAAAATAAAGG - Intronic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
991186296 5:63812388-63812410 ATGCTGCCCAGGAAGCATAATGG + Intergenic
991339297 5:65589093-65589115 ATTCTTCCCTAAAAGAATAAAGG - Intergenic
995147143 5:108799195-108799217 ATTCTGTCATATAAAAATAAGGG + Intronic
996833856 5:127769651-127769673 ATTCTGTCCTAGAAACAGAAAGG + Intergenic
997036342 5:130196760-130196782 CTGTTGTAATAGAAGAATAATGG - Intergenic
998667745 5:144317624-144317646 ATGCATTCCTAGAAGAAATAAGG - Intronic
999907556 5:156159017-156159039 ATGCTATCTTTGAAAAATAATGG + Intronic
1000883344 5:166721903-166721925 AGGCTGTACAAGAAGCATAATGG + Intergenic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1007651769 6:43427072-43427094 ATGCAGCCCTAGAATAATAAGGG + Intergenic
1008320630 6:50108496-50108518 AATCTGTCCTTGAAGCATAAAGG + Intergenic
1013889989 6:115014798-115014820 GTGTTGTCCAATAAGAATAATGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1015809260 6:137145308-137145330 TTGCTGTATTAGAAGAATGAAGG + Exonic
1015905766 6:138115005-138115027 ATGCTGGTTTAGAAGAAGAAAGG - Intergenic
1016346111 6:143116252-143116274 ATGCTGTGGTAGGAAAATAATGG + Intronic
1016393250 6:143596240-143596262 ATGAAGACCTAGAGGAATAAAGG - Intronic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1021200472 7:17723440-17723462 ATGCTGTTTGAGAAGAATCAAGG + Intergenic
1021471334 7:21005262-21005284 AAGCTGTCCTTCAAAAATAAAGG + Intergenic
1021740534 7:23681137-23681159 ATTCTGAGCCAGAAGAATAAGGG + Intronic
1023187684 7:37548866-37548888 CTGCTGTCCTAAAAGATTTAGGG + Intergenic
1023377074 7:39566981-39567003 ATGCTGTCAGAGGACAATAAGGG + Intronic
1024138752 7:46439617-46439639 TTGCTGTCCCAGAATAATATGGG - Intergenic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1025062896 7:55826490-55826512 AAGCTGTCCTTTAAGAATAAAGG + Intronic
1026975273 7:74494033-74494055 ATGCAGTCCAAGATAAATAACGG - Intronic
1027452290 7:78345992-78346014 ATCCTGTCCTGGAAGCAAAAAGG - Exonic
1028239200 7:88398852-88398874 CTGTTTTCCCAGAAGAATAAAGG - Intergenic
1030137182 7:106265739-106265761 ATACTGTACTAGAAGAATAGAGG - Intronic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1035849003 8:2895578-2895600 ATCCTATCCAATAAGAATAATGG - Intergenic
1037342964 8:17866865-17866887 ATGCTGACTTAGAAGAACAAGGG + Intronic
1039332757 8:36557381-36557403 ATGCTTTTCTAGAAGGATATGGG - Intergenic
1039400779 8:37267135-37267157 AAGCTGTCCCAGGAGAATGATGG - Intergenic
1039585055 8:38699993-38700015 ATGCATTCCTAAAAGAAGAATGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1040876445 8:52157391-52157413 AGGCTGTCCTATGAGAATACAGG - Intronic
1042371202 8:67992589-67992611 ATGCTGTACTAGAACATCAAAGG - Intronic
1043784451 8:84380491-84380513 CTCCTGGCCTATAAGAATAATGG + Intronic
1043933077 8:86112842-86112864 ATGCTGGGTTATAAGAATAAGGG + Intronic
1044316733 8:90757871-90757893 TTGCTGTCCTAAAAAGATAATGG + Intronic
1045962333 8:107982796-107982818 ATGATGTCCCAGAAGCAGAATGG - Intronic
1047095946 8:121625949-121625971 ATGCTGACATAGAACAGTAAGGG - Intronic
1048776311 8:137950375-137950397 ATGATGTAATAGAAAAATAATGG - Intergenic
1048978095 8:139684462-139684484 AAACTTTCCTAGAAGAAAAAGGG + Intronic
1052984487 9:34476555-34476577 GAGCTGTGCTAGAAGAACAAGGG + Intronic
1054937121 9:70699884-70699906 ATGTTGACTTACAAGAATAAAGG + Intronic
1058664694 9:107300929-107300951 ATTCTGACCTATAAAAATAATGG - Intronic
1059195506 9:112367480-112367502 ATGCTGTCCTTCAGAAATAAAGG - Intergenic
1059260450 9:112971049-112971071 CTGCTTTCCCAGAAGAAAAATGG - Intergenic
1059663554 9:116425025-116425047 AAGCTGTGCTAGAGGAAGAATGG - Intergenic
1060653871 9:125354587-125354609 ATACTCTCTTTGAAGAATAAGGG - Intronic
1187587091 X:20675310-20675332 ATGCTGCCCTAGCAGCAGAATGG + Intergenic
1188850181 X:35122558-35122580 AAGCTGGCCTAGAAGGGTAAAGG - Intergenic
1193186169 X:78515323-78515345 AAGCAGTTCTGGAAGAATAATGG + Intergenic
1193500002 X:82263694-82263716 ATACTATTCTAGAAGAATAAGGG - Intergenic
1194901421 X:99516191-99516213 ATGTTGTTCTTGAACAATAATGG - Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1196150567 X:112369046-112369068 ATGCTGGCCAAAAAGAATATGGG - Intergenic
1196766793 X:119253330-119253352 ATACTGGCTTAGAAGAATATGGG + Intergenic