ID: 1108026511

View in Genome Browser
Species Human (GRCh38)
Location 13:46183816-46183838
Sequence CAGGATGTGGAACCAGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108026511_1108026519 0 Left 1108026511 13:46183816-46183838 CCCTGATCTGGTTCCACATCCTG 0: 1
1: 0
2: 0
3: 18
4: 168
Right 1108026519 13:46183839-46183861 GTGGCTTCAGGATGGCATAAAGG 0: 1
1: 0
2: 1
3: 10
4: 148
1108026511_1108026524 26 Left 1108026511 13:46183816-46183838 CCCTGATCTGGTTCCACATCCTG 0: 1
1: 0
2: 0
3: 18
4: 168
Right 1108026524 13:46183865-46183887 AACAGTAACACTTCATGAAGGGG 0: 1
1: 0
2: 1
3: 10
4: 167
1108026511_1108026517 -8 Left 1108026511 13:46183816-46183838 CCCTGATCTGGTTCCACATCCTG 0: 1
1: 0
2: 0
3: 18
4: 168
Right 1108026517 13:46183831-46183853 ACATCCTGGTGGCTTCAGGATGG 0: 1
1: 0
2: 1
3: 22
4: 223
1108026511_1108026522 24 Left 1108026511 13:46183816-46183838 CCCTGATCTGGTTCCACATCCTG 0: 1
1: 0
2: 0
3: 18
4: 168
Right 1108026522 13:46183863-46183885 CCAACAGTAACACTTCATGAAGG 0: 1
1: 0
2: 1
3: 7
4: 100
1108026511_1108026523 25 Left 1108026511 13:46183816-46183838 CCCTGATCTGGTTCCACATCCTG 0: 1
1: 0
2: 0
3: 18
4: 168
Right 1108026523 13:46183864-46183886 CAACAGTAACACTTCATGAAGGG 0: 1
1: 1
2: 0
3: 17
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108026511 Original CRISPR CAGGATGTGGAACCAGATCA GGG (reversed) Intronic
902064130 1:13670220-13670242 CTGGATTTGGAACCAGATTTTGG - Intergenic
903803871 1:25990285-25990307 CAGGAGGGGAAAACAGATCAAGG + Intronic
904086448 1:27912763-27912785 CAGGCTATGGAGCCAGAACATGG - Intronic
904299187 1:29543148-29543170 CAGGAGAGGGAACAAGATCAAGG - Intergenic
904306173 1:29591860-29591882 CAGGATGGGGAAGCAGAGGAGGG - Intergenic
904614100 1:31740578-31740600 CAGGAGCTGGAACCAGACCCTGG + Intronic
905314422 1:37072631-37072653 AGGGAGGTGGAACCACATCAGGG + Intergenic
908008709 1:59753844-59753866 CAGGATTTTTAACCAGAGCAGGG - Intronic
908825541 1:68129547-68129569 CTGGATGAGGACCCAGATAATGG + Intronic
909885163 1:80932386-80932408 GAGGATGTTGAAGCAGATAAAGG + Intergenic
910193066 1:84613915-84613937 CAGAATTTGGTACCAGATCTGGG - Intergenic
912269546 1:108194926-108194948 TAGGCTGTGGAATCAGAACAGGG - Intronic
912484700 1:110016648-110016670 CAGGCTGTGGAAACAGACAAGGG - Exonic
912919431 1:113851606-113851628 CAGGATGTGGTAACAGAATATGG - Intronic
913025204 1:114831927-114831949 CAGGATGTAAAACAAGATGAAGG + Intergenic
915895616 1:159808956-159808978 CAGGAGGTGGAAACAGCTCTGGG - Exonic
917791427 1:178501623-178501645 GAGGATGTGGAAACAGATTTAGG - Intergenic
923641665 1:235768003-235768025 CAGGATGTGAAACCAGAAAAAGG - Intronic
924864394 1:247961642-247961664 CTGGATGTGGATCCTGATCTTGG - Intronic
1063970291 10:11377025-11377047 CAGGAGGTTGAACTAGTTCAGGG - Intergenic
1064300609 10:14119514-14119536 CAGCATTTGGAAGCAGATCAGGG + Intronic
1065408729 10:25397744-25397766 GAGGATGTGGAAGCAGAACCTGG - Intronic
1070723223 10:78770997-78771019 CAGGATTTGAAACCAGGACAGGG - Intergenic
1071294767 10:84211645-84211667 CAGGCTGTGGATCCAGATACAGG + Exonic
1072084859 10:92068739-92068761 CAGGACGTGGAAGGAGAGCATGG + Intronic
1072464293 10:95648941-95648963 CAGGTTTTGGAACCAGTTCCTGG - Intronic
1074976777 10:118587496-118587518 CAGGATCTGGAAGCAGCTAAGGG + Intergenic
1075837418 10:125466604-125466626 CAGGATTTGAAGCCAGGTCATGG + Intergenic
1076716500 10:132366877-132366899 CAGGATGTGGAGCCACTTCATGG + Intronic
1076908675 10:133376835-133376857 CAGGCTGTGGCACCACATCCAGG + Intergenic
1087264342 11:96044142-96044164 CAAGCTGTGGAACAAGAACAGGG + Intronic
1088976912 11:114823832-114823854 CTGGATGTGGAACCTGCACATGG - Intergenic
1092910302 12:13140149-13140171 TTGGATGTGGGACCAGATGAGGG - Intronic
1096843123 12:54391082-54391104 CCAGATGTGGAGCCAGATGAAGG + Intronic
1097172863 12:57127541-57127563 CAGGATTTGGAATAAGATGAGGG - Intronic
1098217401 12:68234890-68234912 CAGGATGGGGAGCAAGTTCATGG + Intergenic
1101751992 12:107589548-107589570 CAGGATGTGCAACCAGAGAGGGG + Intronic
1102961126 12:117093951-117093973 CAGGAAGTGGGGCCAGCTCAAGG + Intronic
1106710969 13:32332269-32332291 CAGGATTTGGAAAAACATCAGGG + Exonic
1107004517 13:35593216-35593238 CAAGATGTGGAGGCAGATCAGGG - Intronic
1108026511 13:46183816-46183838 CAGGATGTGGAACCAGATCAGGG - Intronic
1109206710 13:59490749-59490771 CAAGATGTGAGAGCAGATCATGG - Intergenic
1109468085 13:62764902-62764924 CAGGATGTGTGACCAAAGCAGGG + Intergenic
1112714167 13:102164564-102164586 CAGGATGGGGAACAAGAAGAGGG + Intronic
1114635002 14:24182400-24182422 CAGCCTGTGGAGCCAGGTCAGGG + Exonic
1117766055 14:59084622-59084644 CACGACGTGGAACCAGATGTAGG - Intergenic
1117973267 14:61272891-61272913 CAGGCTGTGGAACCAGAGGAGGG - Intronic
1118327548 14:64791844-64791866 CAGGATGTCGAACCTGATATGGG + Exonic
1118864879 14:69694978-69695000 CAGGGTGTGGCACCAGAGCTGGG - Intronic
1119323570 14:73745539-73745561 CAGGATGTGAGCCCAGATGAGGG - Intronic
1120816793 14:88869184-88869206 AAGGATGTGGAGCCTGAACAGGG + Intronic
1123006374 14:105325721-105325743 CAGGATGTGGATCCACAGCGAGG + Intronic
1125711893 15:41793782-41793804 CAGCATGGGGACCCAGGTCAAGG + Intronic
1126677148 15:51170248-51170270 CAGGATGTGGACCCAGGTGAAGG - Intergenic
1126691235 15:51290452-51290474 CAGGATGTGTAGCCAGTTCATGG - Intronic
1126845692 15:52758761-52758783 CAGGGTTTGGCGCCAGATCAGGG + Intronic
1127690068 15:61386675-61386697 CAGGAGATGGAAACAGATCCTGG - Intergenic
1134764300 16:16743211-16743233 CAGGAAGTGGAAGCAGAAAATGG + Intergenic
1134981758 16:18616004-18616026 CAGGAAGTGGAAGCAGAAAATGG - Intergenic
1143263040 17:5614493-5614515 CAGGATGTGGCACCAAAGCTTGG - Intronic
1143269299 17:5664069-5664091 CAGAATGTGGAGACAGATCTGGG + Intergenic
1143423101 17:6811670-6811692 CAGGATGTGGCAACAGGACAGGG + Intronic
1144006628 17:11106189-11106211 CAGGATGTGGAAGGAGCTCCTGG - Intergenic
1144769397 17:17751194-17751216 CAGGAAGTGGAGCCTCATCAAGG + Intronic
1145280948 17:21466590-21466612 CAGGTTGTTGAACCATTTCACGG - Intergenic
1145853489 17:28127890-28127912 CAAGATATGGAGCCAGAACAAGG + Intronic
1147200363 17:38797724-38797746 CAGGATGCAGAACAAAATCAAGG + Intronic
1147360382 17:39926572-39926594 CAGGTTATGAAACCACATCAGGG - Exonic
1152586523 17:81191837-81191859 CAGGGTGTGAAACCAGGTGACGG + Intronic
1153063942 18:1023790-1023812 CAGGCTCTGGAAGCAGCTCAGGG - Intergenic
1155209097 18:23586005-23586027 TAGGATGTGGCACCAGAAGAAGG - Intronic
1157507077 18:48234566-48234588 CAAGATGTGGAAAGAGTTCATGG - Intronic
1157579057 18:48762973-48762995 CAGGAATGGGAACCTGATCAGGG - Intronic
1157648723 18:49304874-49304896 GAGGAAGTGCAAGCAGATCAAGG - Intronic
1157681314 18:49609384-49609406 CAGGAGTTGGAACCAGATTGAGG - Intergenic
1158152197 18:54386211-54386233 CAGGATGTAGAACAAGATGGAGG + Intergenic
1159828661 18:73245679-73245701 CTGGATGTGGCACAACATCATGG + Intronic
1159872542 18:73774960-73774982 CGGGATGTGGAACCAGACAGCGG - Intergenic
1160707695 19:537094-537116 CAGGAAGTGGAAAGAGAGCAAGG + Exonic
1161775393 19:6259319-6259341 CAGGATTTGGAACACGATTAGGG - Intronic
1163657870 19:18558113-18558135 CTGGATCTGGATCCGGATCAGGG + Intronic
1163785297 19:19272043-19272065 CAGGTTGTGGGTGCAGATCAGGG - Intronic
1165064765 19:33222521-33222543 CAGGATTTGGAACCAGATTTGGG - Intronic
1165879007 19:39029814-39029836 CAGGCTGTGTGACCAGACCAGGG + Intronic
1165948538 19:39459458-39459480 CTGGATGTGAAACCAGAGGAAGG + Intronic
1166316467 19:41992438-41992460 CGGGAGCTGGCACCAGATCAGGG - Intronic
1168455068 19:56500411-56500433 GAAGATGAGGAACCTGATCAAGG - Intergenic
1168564481 19:57411756-57411778 CAGGATGTTAAACCAGGACAAGG + Intronic
925284756 2:2708715-2708737 CAGAATCTGGAATCAGATCCAGG + Intergenic
926224420 2:10956772-10956794 CAGCATTTGGACCCAGATCTGGG + Intergenic
926484433 2:13437539-13437561 CAGGATGTGAAGGCAGAGCAAGG + Intergenic
927693040 2:25221884-25221906 CAGGGAGTGGAAACAGATCCCGG + Intergenic
927754533 2:25698144-25698166 CAGGAAGAAGAACCAGAGCAGGG + Intergenic
928796939 2:35034293-35034315 CTGGATGTGGAACAAGAACATGG - Intergenic
931747197 2:65300620-65300642 CAGGATGTGGAGCCAGGAGAGGG - Intergenic
932936746 2:76112350-76112372 CAAGATGTGGCCCCAGAACATGG + Intergenic
932967806 2:76498392-76498414 AAGGATGAGGAAACAGATCTGGG + Intergenic
933131318 2:78677127-78677149 CAGGATGTAGAACAAGATGGAGG + Intergenic
935198009 2:100831815-100831837 CTGGATTTGGATCCAGTTCAAGG + Intronic
935338844 2:102041957-102041979 CAGGCCTGGGAACCAGATCACGG - Intergenic
935998302 2:108798111-108798133 TATGATGTGGAAGCAGAGCATGG + Intronic
938941242 2:136171338-136171360 CAGGATGAAGAACAAGGTCATGG + Intergenic
942714133 2:178871668-178871690 CAGGATGTGGCATGAGCTCAGGG + Intronic
945448908 2:209970997-209971019 CTGGTTGAGGCACCAGATCATGG + Intronic
946519443 2:220449221-220449243 CAAGATGAGGTACCAGATTAGGG + Intergenic
947140092 2:227012554-227012576 CAGGATTTGAAGCCAGACCAGGG + Intronic
947558697 2:231125209-231125231 AAGCATGTTGAACCAGTTCATGG + Intronic
1170367364 20:15612363-15612385 GAGGATGTGGAACAGCATCAGGG - Intronic
1170763807 20:19273772-19273794 CAGGCTGTGGAGACAGCTCATGG - Intronic
1170763907 20:19274273-19274295 CAGGCTGTGGAAACAGCTCATGG + Intronic
1172589757 20:36109278-36109300 CAGGATGAGGACCCAGACCAAGG - Intronic
1175324097 20:58110554-58110576 CAGGGAGGGGAACCAGAACAGGG - Intergenic
1179376540 21:40854312-40854334 CAGAATGAGGAAGCAGCTCAGGG + Intergenic
1184202258 22:42978813-42978835 CAGGAGGAGGAACCAGTTAAGGG - Intronic
951508846 3:23479605-23479627 CTGGATGTGGAACAAGAACTTGG - Intronic
955961151 3:64342477-64342499 CAGCATGAGAAACTAGATCACGG - Intronic
956740793 3:72274168-72274190 GAGGACATGGGACCAGATCAGGG - Intergenic
956844243 3:73167822-73167844 CAGAATCTGAAACCAGCTCAAGG - Intergenic
957240137 3:77649137-77649159 CAGGATTTGAATCCAGTTCAAGG + Intronic
958979847 3:100708660-100708682 GAGGATGAGGAACCCCATCAAGG - Intergenic
959652878 3:108768983-108769005 CTGCATGTGGCAACAGATCATGG - Intergenic
961828172 3:129609484-129609506 TAAGATGTGGAGCCAGATCTGGG - Intergenic
963712820 3:148767086-148767108 CAGGATCTGCCACCAGATAAGGG - Intergenic
974031635 4:56781560-56781582 CAGGATGTGGATCTGGATCTGGG + Intergenic
979882311 4:125976693-125976715 CAGGCTGTGGAATTATATCATGG - Intergenic
982103993 4:151995965-151995987 CAGGTTGTTTAACCAGTTCAGGG + Intergenic
983193692 4:164781914-164781936 CAAGATGTGGAACAAGATTCTGG - Intergenic
985554333 5:549223-549245 CAGAATGTGAAAACAGATCGAGG - Intergenic
988907901 5:35808971-35808993 CAGGCTCTGGAATCAGGTCATGG + Intronic
990679754 5:58229113-58229135 CAGGATGTGGTAGTAGACCATGG + Intergenic
992220036 5:74562754-74562776 GAGGATGCAGAACCAGATCAAGG - Intergenic
992957423 5:81924303-81924325 CAGGATATGGAGGCAGATCTTGG - Intergenic
994818811 5:104621741-104621763 AAGGATGTGGAAGCACATCTAGG - Intergenic
997236477 5:132274930-132274952 CAGGAGGGGGAACCAGATCCAGG + Intronic
1000097978 5:157987623-157987645 CAGCATGTGGAACCACATAGAGG - Intergenic
1000847193 5:166296496-166296518 CAGGTGGTGGAATCATATCAAGG + Intergenic
1001027511 5:168236560-168236582 AAGGATGTGGAACCAGAGCTGGG - Intronic
1002024235 5:176385839-176385861 CAGGATGTGGAGCCAACTAATGG + Intronic
1002642467 5:180636761-180636783 AAGGATGTGGATCAAGAACAGGG - Intronic
1004021403 6:11779222-11779244 CAGGTTGATAAACCAGATCATGG + Intronic
1007009961 6:38407004-38407026 CAGGTAGTGGAAACAGAACAAGG - Intronic
1007022372 6:38533602-38533624 CAGCATATGGAACCTTATCAAGG + Intronic
1008163891 6:48111741-48111763 GAGGATGTGGAACCTGAAAAAGG - Intergenic
1008433683 6:51450214-51450236 GAGTATGTGGAGGCAGATCAAGG - Intergenic
1009014375 6:57880727-57880749 CATGGTGTGAGACCAGATCAGGG + Intergenic
1013648432 6:112169034-112169056 CAGTAGGTGGACTCAGATCATGG + Intronic
1014384780 6:120786561-120786583 CAGGACGTGGGACAAGATCTCGG + Intergenic
1015096161 6:129417178-129417200 CAGGATGTGGGACAAGAACTTGG - Intronic
1020343122 7:7134087-7134109 TAGAATGTGGGACCAGATGATGG - Intergenic
1020343361 7:7136350-7136372 CAGGCTCTGGAGCCAGATAAAGG - Intergenic
1020439767 7:8205015-8205037 CATGATGTGAAACCAGACAATGG - Intronic
1021171941 7:17408307-17408329 CAGGCTGTGAGACCAGATCAGGG - Intergenic
1022591730 7:31670396-31670418 CAGGATCTGTAACCAGTGCAGGG - Intergenic
1022666924 7:32419836-32419858 TAGGATTAGGAACCAGATCCTGG - Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1023402065 7:39797766-39797788 CAGCAAGTGGCACCAGATCCTGG - Intergenic
1023479785 7:40621697-40621719 CAGGATGTGAAATCAAATGATGG + Intronic
1023689345 7:42770138-42770160 CAGGATGAGGAAGCAGAGCGAGG - Intergenic
1023845341 7:44117095-44117117 CGGGAGCTGGAACCAGCTCATGG - Intronic
1024659124 7:51476264-51476286 CAGGAGATGGAATCAGGTCATGG + Intergenic
1027377134 7:77562497-77562519 CAGGATGCATAACCAGATGAAGG + Intronic
1032447551 7:131997617-131997639 CAGGCTAGGGAAGCAGATCATGG - Intergenic
1035783984 8:2248360-2248382 CAGGAGGAGGAACCAGGTGAAGG + Intergenic
1035784006 8:2248436-2248458 CAGGAGGAGGAACCAGGTGAAGG + Intergenic
1035784335 8:2249462-2249484 CAGGAGGAGGAACCAGAGGAAGG + Intergenic
1035784382 8:2249614-2249636 CAGGAGGAGGAACCAGAGGAAGG + Intergenic
1035784427 8:2249766-2249788 CAGGAGGAGGAACCAGAGGAAGG + Intergenic
1037092650 8:14942144-14942166 CAAGATGTGGTACCAGATCCTGG - Intronic
1037234102 8:16696186-16696208 AAGGATGTGGTATCAGATGAAGG - Intergenic
1040806165 8:51398439-51398461 CAGGAAGTTGAATCAGAACACGG + Intronic
1042187197 8:66148663-66148685 GAGAAATTGGAACCAGATCATGG + Intronic
1054718683 9:68582336-68582358 CAAGAGATGGAACCAGAACAAGG + Intergenic
1056791519 9:89628294-89628316 CAGGGTGTGGAACAGGACCAAGG - Intergenic
1059456098 9:114401202-114401224 CAGGATCTGGGACAAGAGCATGG + Intergenic
1060084898 9:120689281-120689303 CAGCATGTGTAACAACATCAAGG + Intronic
1060724796 9:125999627-125999649 CAGGCTGTGGAGCCAGAAGAGGG - Intergenic
1061480151 9:130893800-130893822 CAGGAAGAGGAAGTAGATCAGGG + Exonic
1187461039 X:19486915-19486937 CAGGAAGTGGTTCCAGATCCGGG - Intronic
1188862709 X:35275945-35275967 CAGGATGTAAAACCAGATGGAGG + Intergenic
1189153006 X:38726718-38726740 CAGGATGTGAAACAAGATGGAGG - Intergenic
1189716046 X:43867201-43867223 CAGGAAGTGGAACCATATTCTGG - Intronic
1194495688 X:94614319-94614341 TAGGAGGTGGAACAAGATGATGG - Intergenic
1195880251 X:109586054-109586076 CTGGATGTGGAACAAGAACTTGG - Intergenic
1195925484 X:110020558-110020580 CAGGAAGTGGAATGAGATCCAGG + Intronic
1197768797 X:130075970-130075992 CAGGCTGTGGACCAAGATAAGGG + Intronic
1198882893 X:141300474-141300496 CAGGATGTTGAAGGAGATCAAGG - Intergenic
1200918781 Y:8594627-8594649 AAAGATGTGGAGCCAGATCTAGG - Intergenic