ID: 1108026843

View in Genome Browser
Species Human (GRCh38)
Location 13:46186875-46186897
Sequence GTGTTTCATGAGAAGCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108026843 Original CRISPR GTGTTTCATGAGAAGCCTTG AGG (reversed) Intronic
901304074 1:8219729-8219751 GTGTTTAAGGAGAATCTTTGGGG + Intergenic
902561968 1:17283174-17283196 GTGTTCCATCTGGAGCCTTGGGG - Exonic
911234986 1:95403000-95403022 GTGTTGGAGGAGAGGCCTTGTGG + Intergenic
913090847 1:115475588-115475610 GTTCTCCATGAGCAGCCTTGGGG - Intergenic
917240533 1:172943274-172943296 GTGTTTGAGGAGGAACCTTGTGG + Intergenic
919750928 1:201037738-201037760 GTGTTTCCAGAGAAGCGATGGGG + Intergenic
919844181 1:201630623-201630645 TTCTTCCATGACAAGCCTTGTGG + Intronic
920022425 1:202966451-202966473 GTGTTTCATGAGATCCCAGGAGG + Intronic
920847365 1:209605454-209605476 GTGTTTGCTTTGAAGCCTTGGGG - Intronic
922592428 1:226787407-226787429 GTGTTTGGTCAGAAGGCTTGGGG + Intergenic
924303018 1:242658975-242658997 GTGGCTCATGAAAACCCTTGCGG + Intergenic
1063240251 10:4161902-4161924 GTGTTGGAAGAGAAGCCTGGTGG - Intergenic
1065181348 10:23129362-23129384 GTGTCTCATGGGACACCTTGTGG - Intergenic
1066666639 10:37789720-37789742 GTGTTGACTGAGAAGCCTAGAGG + Intronic
1067718320 10:48706638-48706660 GTGTTTCAGGAGCAGCCGTTTGG + Intronic
1070005658 10:72421667-72421689 GAGTTTTTTGAGCAGCCTTGAGG - Intronic
1071874622 10:89831227-89831249 GCTTTTCATGAGAAGACATGGGG - Intergenic
1072544754 10:96428360-96428382 GTGTGTCATGTGAAGACTTAAGG - Intronic
1073116335 10:101093940-101093962 CTGCTCCCTGAGAAGCCTTGAGG + Intronic
1073997070 10:109327820-109327842 GTTTTTAATGAGAAGCATTCTGG - Intergenic
1075385377 10:122051615-122051637 GTGTATCATGACAGGCCTTAAGG + Intronic
1076230200 10:128814078-128814100 CTGTGTCATGAGAAACCTGGAGG - Intergenic
1080396238 11:31892848-31892870 GTGATTCATGAAAAAGCTTGGGG - Intronic
1080550412 11:33369538-33369560 AATTTTCATGAGAAGCTTTGAGG - Intergenic
1081714766 11:45241921-45241943 CTCTTTCATGAGAAGTCTTTTGG - Exonic
1082309692 11:50631676-50631698 GAGTTTCATATGAAGCCTGGTGG + Intergenic
1085497010 11:76978970-76978992 GTGTTTAATGAGCAAGCTTGGGG - Intronic
1087012763 11:93529344-93529366 GTGTTTCAGGAGTTGCCTTTGGG - Intronic
1087577583 11:100009388-100009410 GTGTTTCAAGAGAACCCATAGGG + Intronic
1087825799 11:102763467-102763489 CAGTTTCATGCTAAGCCTTGGGG - Intergenic
1088653955 11:111981420-111981442 GTGTTTCATTACAACTCTTGTGG - Intronic
1089961230 11:122618781-122618803 GTGTTGCCTGAAAAGCCTTGGGG + Intergenic
1092591682 12:9957994-9958016 CTTCTTCATGAGCAGCCTTGAGG - Intronic
1093386226 12:18558584-18558606 GTGTTTAATGAGCAGCAGTGTGG - Intronic
1097266815 12:57750795-57750817 GTGTTTCATGGTAACCCATGGGG - Intronic
1097535948 12:60870984-60871006 GTTTTTCATTATAAGCCTTGTGG - Intergenic
1099525167 12:83710303-83710325 GTGTTGCAGGAAAAGCCTGGTGG - Intergenic
1099558423 12:84141650-84141672 GTCTTTCCTGACAAGCCATGGGG - Intergenic
1099685870 12:85888158-85888180 GTGTTTGATTGGAAGCCTTCAGG - Intergenic
1101205416 12:102482306-102482328 TTGTGTCATGAGAGGCTTTGGGG + Intergenic
1101706970 12:107229878-107229900 GTTCTTCAGGAGAAGCCTTTGGG + Intergenic
1108026843 13:46186875-46186897 GTGTTTCATGAGAAGCCTTGAGG - Intronic
1108936308 13:55885550-55885572 GTGGTACATGAGAATCCATGGGG + Intergenic
1110061695 13:71048444-71048466 GAATTTCAAGTGAAGCCTTGTGG - Intergenic
1111602646 13:90494599-90494621 GTATTTCATAAGAAGCTCTGTGG + Intergenic
1111612724 13:90624395-90624417 GTATTTCAGGAGTGGCCTTGAGG + Intergenic
1112423953 13:99279362-99279384 GTGTTTCAAGAGAAGCTTAAAGG + Intronic
1113492289 13:110701731-110701753 GTTTCTCCTGAGAACCCTTGTGG - Intronic
1113931957 13:113973370-113973392 GTTTTTCATGAGCAGCCCAGAGG - Intergenic
1116666940 14:47788744-47788766 GTGTTGGATGAGGAGCCTGGTGG - Intergenic
1118255574 14:64202305-64202327 GGGTCCCATGAGAGGCCTTGTGG + Intronic
1118743860 14:68760159-68760181 CTGTTTCCTGAGAGCCCTTGTGG - Intergenic
1118912066 14:70069738-70069760 CTGTTCCATGAGAAGGCTTAGGG + Intronic
1121631140 14:95422750-95422772 GGGTTTCATGAGAGGCAGTGGGG - Intronic
1124645570 15:31435582-31435604 CTGTTTCCTGAGAAGCCCAGGGG + Intronic
1124872388 15:33556013-33556035 GTGTCTCTGGAGAAACCTTGAGG - Intronic
1125084715 15:35716434-35716456 GTGTTTCATGAAAGACCTTGTGG + Intergenic
1126282153 15:46966167-46966189 ATGTTTCATCAGAACCCCTGGGG + Intergenic
1130033094 15:80333501-80333523 GTGTTTCATGAGAAAGCTGGAGG - Intergenic
1130625041 15:85505665-85505687 GTGTTGCATGAGATACTTTGAGG + Intronic
1139346866 16:66309441-66309463 GTGTTTGCTGGGAAGCCATGGGG - Intergenic
1141204381 16:81922215-81922237 ATGTTTCATAAGAAGCAATGTGG - Intronic
1144166478 17:12616313-12616335 GTCTTTAATGTGAAGACTTGGGG - Intergenic
1146737489 17:35251354-35251376 GTGTTGCATGAGAAACCATGAGG - Intronic
1146753862 17:35408788-35408810 CTGTTTAATGAGAAGCAGTGGGG - Intergenic
1148823024 17:50371608-50371630 GTGTCTTTAGAGAAGCCTTGTGG + Intronic
1149159502 17:53673620-53673642 TTGTTTCAAGAGAAGCTTTTAGG - Intergenic
1149393519 17:56215880-56215902 GTGTTGCCGGAGAAGCCTAGAGG + Intronic
1150268595 17:63847843-63847865 GAATTTCATGAGAAGCAATGTGG + Intergenic
1150486628 17:65548578-65548600 GTGTTGGGTGAGAAGCCTTTGGG + Intronic
1151373510 17:73666174-73666196 GTGTTGGAGGAGAAGCCTGGTGG + Intergenic
1155235589 18:23815955-23815977 GAGATTCAAGAGTAGCCTTGCGG - Intronic
1157996232 18:52559511-52559533 GTGTTGCATGCTAAGCCTTGTGG - Intronic
1158261346 18:55609330-55609352 GTTTTTCATGAAAATCCTTGAGG + Intronic
1158906344 18:62016514-62016536 TTGTTTCATGTGTAGCCTTCTGG - Intergenic
1161678480 19:5666970-5666992 ATGTTGCCTGAAAAGCCTTGGGG + Intronic
1164394729 19:27852574-27852596 GTGTTTCATGAGAAAGAATGTGG - Intergenic
1164888716 19:31804917-31804939 GTGTTTCATGTGACTCCGTGAGG + Intergenic
1165161876 19:33821095-33821117 CTGATGCAAGAGAAGCCTTGAGG - Intergenic
1166902207 19:46073440-46073462 TAGTTTCATAGGAAGCCTTGGGG + Intronic
925773676 2:7310030-7310052 TTGTTTGATGAGAAACCTGGTGG - Intergenic
926731609 2:16039709-16039731 GCTTTTCACAAGAAGCCTTGGGG - Intergenic
927217357 2:20675531-20675553 GTCTCTCAGGAGACGCCTTGTGG - Intergenic
927636541 2:24820933-24820955 GTGTTACATTAGGAGCTTTGTGG - Exonic
930469521 2:51794995-51795017 TTGTTTCATAGGAATCCTTGGGG + Intergenic
932723924 2:74161111-74161133 GTGTTTCAAGAGTAGCGTTGTGG - Intronic
933162118 2:79036909-79036931 GTTTGTTATGGGAAGCCTTGGGG + Intergenic
934970863 2:98762952-98762974 GTCTTTGATGACAAGCCCTGGGG + Intergenic
936730216 2:115374013-115374035 GTGTTGCAAGAGAGGCCTGGTGG - Intronic
937178934 2:119971345-119971367 GTGTTGGAGGAGAGGCCTTGTGG - Intronic
938914394 2:135920831-135920853 GAGGTTCATGAGAACCCTGGGGG + Intronic
940130457 2:150375526-150375548 GTTTTTCATGCCAACCCTTGAGG + Intergenic
941486003 2:166083617-166083639 GTGTTTCATGAGAAAACTACAGG - Intronic
941674030 2:168324841-168324863 CTATTTCATTAGAAACCTTGAGG - Intergenic
943774679 2:191751998-191752020 GTGTTTCATAAAAAGCCTCATGG + Intergenic
944616635 2:201466773-201466795 GTGATTCATGAGAGGCCATCTGG + Intronic
946395314 2:219441373-219441395 GGCTTTCTTGAGAAGCCTTAGGG + Intronic
947465078 2:230336471-230336493 CTGTTTCATGAGAATCTATGAGG + Intronic
1171379564 20:24724157-24724179 GTGCTGCATGAGGAGCCGTGAGG + Intergenic
1171986206 20:31663013-31663035 GTGTTTTATGAGTTGCTTTGGGG - Intergenic
1173029259 20:39339708-39339730 GACTTTCATGGGAAGCCCTGTGG - Intergenic
1175259715 20:57666863-57666885 GTTTTTCATGACAAGCCCCGAGG + Intronic
1175766439 20:61595883-61595905 GGGTTTTATGGGAAGCCGTGCGG - Intronic
1176067844 20:63208388-63208410 GTTCTTCAGGAGAAGCCTTAGGG + Intronic
1177315344 21:19453647-19453669 GTGATTCATGATGAGTCTTGTGG - Intergenic
1177396983 21:20549216-20549238 GTGTTGGAGGAGAAGCCTGGTGG + Intergenic
1177420176 21:20846035-20846057 GGTTTTCATGAGAAGCCTTGGGG + Intergenic
1177509934 21:22073727-22073749 GTTTTTCATGAAAAGTTTTGTGG + Intergenic
1177534525 21:22406719-22406741 GTGTGTCATGATATGCCATGTGG - Intergenic
949646778 3:6104924-6104946 GTGCTTCATGAGAAGGCCAGAGG + Intergenic
951661965 3:25076864-25076886 ATGTCTCATGGGAAGCATTGTGG - Intergenic
952193200 3:31045699-31045721 GTCTTACATGAGATTCCTTGGGG + Intergenic
957691504 3:83576730-83576752 ATGTTGCAGGTGAAGCCTTGTGG - Intergenic
958740113 3:98058827-98058849 GTGTTGCAGGAGAGGCCTGGTGG - Intergenic
960746170 3:120891366-120891388 GAGGTTCATGAGAAACCTGGAGG + Intergenic
961522555 3:127475427-127475449 GTGAGTGATGGGAAGCCTTGAGG - Intergenic
964372480 3:156015354-156015376 GTTATTCATGAGAGGCCTCGGGG - Intergenic
969103471 4:4787520-4787542 GTGTTGCATGAGGAGCCTGGTGG + Intergenic
969180259 4:5435216-5435238 TTGTTTCATGGAAGGCCTTGGGG + Intronic
969938926 4:10710881-10710903 GAATTTGATGAGAAGCATTGTGG + Intergenic
970252119 4:14127441-14127463 CTGCTTCATGACAAGCCTTGAGG - Intergenic
972668906 4:41195219-41195241 GTGTTTCATCAGCATCCTAGTGG - Intronic
973293755 4:48493354-48493376 GTGCTTCATAAGAAGCGTTTCGG - Intronic
975449961 4:74513338-74513360 TTCTTTCATGAGGTGCCTTGAGG + Intergenic
976260447 4:83140222-83140244 GTTTTTCATGAGATGCCATGAGG - Intergenic
978289318 4:107118668-107118690 CTGTCTCATGAGAGGCCTTCTGG - Intronic
979835708 4:125364885-125364907 GTGTTTCATAAAAAGCTTTCTGG + Intronic
980864243 4:138535920-138535942 GTGTTTGAAGAAAGGCCTTGTGG + Intergenic
982321582 4:154082594-154082616 GCATTGCATGAAAAGCCTTGTGG + Intergenic
982438479 4:155404545-155404567 AGGTTGCATGAGCAGCCTTGTGG + Intergenic
983068323 4:163237756-163237778 GTTTTTCATGAGGATCTTTGAGG - Intergenic
984055747 4:174927794-174927816 GGGTTTCAGGATAAGCCTGGTGG + Intronic
986700095 5:10398281-10398303 GTCTTTAATAAGAAGCCATGTGG + Intronic
987042716 5:14077889-14077911 GTGTTTCATGAGATGAGTGGAGG - Intergenic
987216719 5:15744980-15745002 GTGTTTCCTGAGAGACCTGGTGG - Intronic
987310038 5:16673199-16673221 TTTTTCCATAAGAAGCCTTGGGG + Intronic
987861859 5:23499677-23499699 GTGTTGGAGGAGAAGCCTTCTGG - Intergenic
993302778 5:86232679-86232701 GTGTTTTAAGAATAGCCTTGGGG - Intergenic
993430626 5:87828399-87828421 GTGTTTAATGAGAACACTTTTGG + Intergenic
995358607 5:111268004-111268026 GTTTTCCATGAGAAGCCTATTGG + Intronic
998629377 5:143881444-143881466 GTATCTCCTGAGAAGCCTTCCGG + Intergenic
1001908198 5:175490825-175490847 TTATTTCATGAGCATCCTTGTGG - Intronic
1004315494 6:14583622-14583644 CCGTGTCATGAGCAGCCTTGTGG - Intergenic
1007287603 6:40758788-40758810 CTCTTCCAAGAGAAGCCTTGGGG - Intergenic
1007753360 6:44083298-44083320 GGGTTTAATGAGAAGCCTCAGGG + Intergenic
1008367950 6:50704583-50704605 TGGTGTCATGAAAAGCCTTGAGG - Intergenic
1012516942 6:100072777-100072799 GGGTTGCAGGAGGAGCCTTGAGG + Intergenic
1012990045 6:105916182-105916204 TTGGGTCATGAGAGGCCTTGCGG + Intergenic
1013812558 6:114061285-114061307 ATGGTTATTGAGAAGCCTTGAGG - Intronic
1014038237 6:116792941-116792963 GTTTTACATGTGAAGTCTTGTGG + Exonic
1014173788 6:118309038-118309060 GTGGTACATGAGAAGCCATCAGG + Intronic
1016856504 6:148676055-148676077 GTATTTCATGTGTAACCTTGAGG - Intergenic
1017447478 6:154520348-154520370 GTCTTCCATGAGACGCCTTCAGG - Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1023334460 7:39153806-39153828 CAGTACCATGAGAAGCCTTGCGG + Intronic
1023338054 7:39190270-39190292 GTGTATCATGAGGAGCATTTAGG - Intronic
1023580123 7:41672841-41672863 CTGTCTTATGAGAGGCCTTGTGG - Intergenic
1023797224 7:43803848-43803870 GTAAGTCATGAGAAGCCATGAGG + Intronic
1024318719 7:48044674-48044696 GTCTTTAATGAGAACCCTTTGGG - Intronic
1026808751 7:73444644-73444666 GTATTTAATGAGGAGCCTTGTGG - Intronic
1028432358 7:90762194-90762216 GTGTTTCATGCCAGGCCCTGAGG + Intronic
1029509902 7:100987554-100987576 GTGTTGCAGGAGGGGCCTTGTGG + Intronic
1032607840 7:133376627-133376649 TTGTTTCCTGCCAAGCCTTGTGG - Intronic
1034293596 7:149951137-149951159 GTGTTTCATGAGGAGCAGGGTGG + Intergenic
1034812470 7:154145716-154145738 GTGTTTCATGAGGAGCAGGGTGG - Intronic
1036736759 8:11325892-11325914 GTGATTTTTGAGAAGACTTGGGG + Exonic
1037165018 8:15816888-15816910 CTCTTTCATGAGAAACATTGGGG - Intergenic
1040438366 8:47415862-47415884 GGGTGGCATGAGAATCCTTGGGG - Intronic
1045252415 8:100492916-100492938 TTTTTTCAGGACAAGCCTTGGGG - Intergenic
1049731112 8:144179006-144179028 GTTTTTCCTTAGCAGCCTTGGGG + Intronic
1059557194 9:115293154-115293176 GTGTGTGGTGACAAGCCTTGTGG + Intronic
1061242507 9:129382765-129382787 GTGTCTGTTGAGAAGCTTTGGGG + Intergenic
1061516251 9:131092208-131092230 TTGTTACATGAGATGCCCTGGGG + Exonic
1185950233 X:4424210-4424232 GTGTTTGAGGAGAGACCTTGTGG - Intergenic
1186741532 X:12523304-12523326 ATGTTTCATGAGAGCCCATGAGG - Intronic
1187488487 X:19726996-19727018 GTGTTTCTTGAGAAGCGTGATGG - Intronic
1189124339 X:38430235-38430257 ATATTTAATGAAAAGCCTTGAGG - Intronic
1192931542 X:75811598-75811620 GTGTTGGAGGAGAGGCCTTGAGG + Intergenic
1193301080 X:79889521-79889543 GTCTTTCAAGAGAAGCATTTAGG - Intergenic
1195600518 X:106742028-106742050 ATGTTTCATTAGTAGCCATGAGG + Intronic
1197861499 X:130975888-130975910 GTTTTTCTTGAGATCCCTTGTGG + Intergenic
1200384885 X:155880642-155880664 GTGTTTGATGAGGGGGCTTGGGG + Intergenic