ID: 1108027875

View in Genome Browser
Species Human (GRCh38)
Location 13:46197405-46197427
Sequence CCGGTCCCAGTAGGTGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108027871_1108027875 -2 Left 1108027871 13:46197384-46197406 CCGAATAAGTGGATAACTCTGCC 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1108027875 13:46197405-46197427 CCGGTCCCAGTAGGTGCCATTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1108027869_1108027875 20 Left 1108027869 13:46197362-46197384 CCGGAGATAGAAAGCAGTGCTTC 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1108027875 13:46197405-46197427 CCGGTCCCAGTAGGTGCCATTGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108027875 Original CRISPR CCGGTCCCAGTAGGTGCCAT TGG Intronic
901271288 1:7953982-7954004 CTGGGCCCAGCAGGTGCCAAGGG + Intergenic
901690335 1:10969096-10969118 CCGGTCCCAGAAGGTGCTTTAGG + Intronic
912499522 1:110112801-110112823 CCAGTCCCAGCTGGTGCCACAGG - Exonic
1065974439 10:30829988-30830010 ACGCTCCCAGAAGGTGACATTGG + Intronic
1075718379 10:124570199-124570221 ACGGTCACTGTGGGTGCCATGGG - Intronic
1077357208 11:2123884-2123906 CTGGCCACAGCAGGTGCCATTGG + Intergenic
1078100966 11:8330130-8330152 CCGCTCCCAGGACGGGCCATAGG + Intergenic
1087994004 11:104781075-104781097 CGGGTCCCACTATGTGTCATGGG + Intergenic
1096124058 12:49106873-49106895 CCTTTCCCAGTGGGTACCATAGG + Intronic
1103897043 12:124279761-124279783 CAGCTCCCCGCAGGTGCCATGGG - Intronic
1104783610 12:131436010-131436032 CAGGTGCCAGTAGGGGCCAAGGG + Intergenic
1108027875 13:46197405-46197427 CCGGTCCCAGTAGGTGCCATTGG + Intronic
1113750002 13:112770486-112770508 CCTGTCCCAGCAGATGCCAGTGG + Intronic
1114244947 14:20904474-20904496 CATGTCCCAGTAGCTGCCACTGG + Intergenic
1121287522 14:92748144-92748166 CCAGTCCCAGTAGGGGCCCTTGG + Intronic
1129324590 15:74793435-74793457 CAGGCCCCAGGAGTTGCCATGGG - Intronic
1132239938 15:100249665-100249687 CCCCTTCCAGTAGGTGCCCTTGG + Intronic
1135824588 16:25715378-25715400 CCAGTGCCAGTAGGTGCCTGGGG - Intronic
1139779663 16:69340041-69340063 ACGGAAACAGTAGGTGCCATCGG - Exonic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1145013859 17:19384519-19384541 CTGGGCCCAGTTGATGCCATTGG + Exonic
1147437460 17:40425960-40425982 CCAGTTCCAGCAGCTGCCATCGG - Intergenic
1160857093 19:1222511-1222533 CCGGTCTCAGTGGGTGGCCTCGG - Intronic
1161027754 19:2044482-2044504 AGGGTCCCAGCAGGTGCCAGGGG - Intronic
1163077676 19:14909496-14909518 CTGGTACCAGTAGGTACCGTAGG + Intergenic
1163077716 19:14909805-14909827 GCGGTACCAGTAGGTACCATAGG + Intergenic
1163366426 19:16878378-16878400 CCGGGCCAAGCAGGTGCCAGGGG + Exonic
1163710175 19:18841848-18841870 CCGGTCCACACAGGTGCCATTGG + Intronic
1168109984 19:54186917-54186939 AGGGTAACAGTAGGTGCCATTGG - Intronic
927490191 2:23516239-23516261 CCGGGCCCAGCAGGTGCCCATGG - Intronic
927833073 2:26370543-26370565 CACGTCCCAGTAGGGGCCACCGG + Intronic
927833124 2:26370669-26370691 CACGTCCCAGTAGGGGCCACCGG + Intronic
937884513 2:126890688-126890710 CCTGTCCCAGTGGGTCACATGGG + Intergenic
1176035212 20:63032907-63032929 GCGGAGCCAGTAGGTGCCAGTGG + Intergenic
1179255620 21:39712955-39712977 CCGCTCCAAGTAGATGACATTGG + Intergenic
1180157234 21:45983584-45983606 CCGTGCCCAGCAGGAGCCATTGG + Intronic
1183977742 22:41523085-41523107 CAGGTCCCAGTGGCTGCCCTGGG + Intronic
1185376002 22:50482825-50482847 CCGGTCCCATGAGTTGCCACAGG - Exonic
949562536 3:5215639-5215661 CCTCTCCCACTAGGTGCCAGTGG - Intronic
949928030 3:9057548-9057570 CCCCTCCCAGCAGGTGCCACGGG + Intronic
950462830 3:13135479-13135501 CAGGGCCCAGGAGGTGACATGGG + Intergenic
950473239 3:13199385-13199407 CCTGTCCCAGGGGGTGCCCTAGG - Intergenic
957922841 3:86769076-86769098 CCACTCACAGTAGGGGCCATTGG - Intergenic
968899413 4:3423986-3424008 CCGGGCCCAGCAGGTGCAGTGGG - Intronic
988721262 5:33881417-33881439 CCAGTCCGAGTAGATGCCAGTGG - Exonic
1002864297 6:1107667-1107689 CTGCTCCCAGTATGTCCCATGGG + Intergenic
1003048424 6:2757671-2757693 CCGGGCACAGTAGATGCAATAGG + Intergenic
1004199210 6:13532442-13532464 CAGCTCCCAGAAGGAGCCATGGG + Intergenic
1007420301 6:41715136-41715158 ACAGTCCCAGAAGGTGCCTTGGG - Intronic
1011503235 6:88013531-88013553 CCTGTCCCAGAAGTTGCCAGAGG + Intergenic
1019999952 7:4749957-4749979 CCGGGCCTAGAAGGTGCCACTGG - Intronic
1028476830 7:91263489-91263511 CAGGTCCCAGGAGTTCCCATCGG + Intergenic
1029380844 7:100213597-100213619 TCCCTCCCAGGAGGTGCCATAGG + Intronic
1033311885 7:140267671-140267693 CTGGGCCCAGTGTGTGCCATGGG - Intergenic
1043785711 8:84397166-84397188 CAGATCCCAGAAGGTGCCCTTGG - Intronic
1046099275 8:109595832-109595854 CAGGTCCCAGTGGTTGCCACTGG + Intronic
1049280446 8:141741437-141741459 CGGGTCCCACTAGGTGCCCTTGG + Intergenic
1057872769 9:98730638-98730660 CCGGTGCCAGTAGCTCACATTGG - Intergenic
1058757593 9:108097650-108097672 CTGTTCCCTGTAGGAGCCATTGG + Intergenic
1185722234 X:2391457-2391479 CCTTTCCCAGGAGGAGCCATAGG + Intronic
1189145397 X:38650165-38650187 CCTGTCCCAGGAAGTGCCAGCGG + Intronic