ID: 1108033077

View in Genome Browser
Species Human (GRCh38)
Location 13:46257164-46257186
Sequence ATGAGGCAGCTTGAAAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108033075_1108033077 -9 Left 1108033075 13:46257150-46257172 CCATGAGTCAAGGAATGAGGCAG 0: 1
1: 2
2: 5
3: 58
4: 400
Right 1108033077 13:46257164-46257186 ATGAGGCAGCTTGAAAACCTGGG 0: 1
1: 0
2: 0
3: 15
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108033077 Original CRISPR ATGAGGCAGCTTGAAAACCT GGG Intronic
901316618 1:8314433-8314455 GGGAGGCAGCAGGAAAACCTCGG - Intergenic
902091384 1:13906526-13906548 AAGAGGCAGACTGGAAACCTGGG - Intergenic
907424301 1:54369416-54369438 AAAAGGCATCTTGAAAACCAAGG + Intronic
909829066 1:80162570-80162592 ATGTGGCACCTTGAAAACTGAGG + Intergenic
910530133 1:88226499-88226521 ATGAGGAAGCATGAAGTCCTGGG - Intergenic
911146013 1:94553307-94553329 GTGAGGCAGCAGGAAACCCTAGG + Intergenic
912122230 1:106485756-106485778 TTCAGGCAGCTTGGAAACCTTGG + Intergenic
912546003 1:110452412-110452434 ATGGGGTAGCTTGAAAATCTGGG + Intronic
913007059 1:114644507-114644529 ATGGGGCAGCTTCAAATCATTGG - Intronic
913302412 1:117386344-117386366 GAGAGGCAGCTTGGAAACATGGG + Intronic
915091207 1:153427658-153427680 ATGAGGCAGCCCTAAAACCCTGG - Intergenic
915093906 1:153445633-153445655 ATGAGGCAGCCCTAAAACCCTGG + Intergenic
915712216 1:157910888-157910910 ATGTGGCTGCTTGTACACCTTGG - Intergenic
918282626 1:183022350-183022372 AGGCAGCAGCTTGAAACCCTTGG - Intergenic
918940395 1:190988102-190988124 ATGAGGCATTTTGAAAATGTAGG + Intergenic
923807981 1:237281402-237281424 ATGAAGCAACATGAAAACTTAGG + Intronic
924045091 1:240021066-240021088 CTGAGGAAGCTTGACAGCCTCGG + Intronic
1062860283 10:805141-805163 ATGAGGCAGCTCCAGAGCCTCGG + Intergenic
1068392894 10:56422496-56422518 ATGTGGCAGCTTGAAGAGATAGG + Intergenic
1069055372 10:63839305-63839327 TAGAGGCAGCTGGAAAAGCTGGG - Intergenic
1070753567 10:78977790-78977812 AGGAGGCAGCTGGAAACCCAGGG - Intergenic
1074282093 10:112062320-112062342 ATGAGGCAACTTCTAACCCTTGG + Intergenic
1079091372 11:17482684-17482706 ATAAGGCAGAGAGAAAACCTTGG + Intergenic
1081799639 11:45848913-45848935 ATAAGGCAGCCTGAAAACTGTGG - Intronic
1086727883 11:90211609-90211631 ATTACTCATCTTGAAAACCTTGG - Intronic
1087063035 11:94000994-94001016 ATATGGCAGCTTGAAAGTCTGGG + Intergenic
1087756271 11:102057681-102057703 ATGAGTCTGTTTGTAAACCTAGG - Intronic
1089423193 11:118347648-118347670 TTGAGACAGCTTTAACACCTAGG + Intronic
1089644124 11:119866736-119866758 AGGAGGCAGCTTTGAAGCCTGGG - Intergenic
1090600555 11:128365557-128365579 AGGAGGAAGCTAGGAAACCTCGG - Intergenic
1091200021 11:133771403-133771425 ATCAGGCATCTTGCAAACCACGG - Intergenic
1091322641 11:134662974-134662996 AGGAGGCAGCTTTAGATCCTGGG + Intergenic
1091743109 12:2974098-2974120 CTAAGGCACCTTGAAAACCTGGG - Intronic
1091974585 12:4814164-4814186 ATGAGGCAGCTTCAATGACTGGG - Intronic
1092337469 12:7646049-7646071 AACAGGCAGCTTGAAAAACCAGG + Intergenic
1095594488 12:43943359-43943381 ATGAGGAAGGTAAAAAACCTTGG - Intronic
1097172446 12:57124686-57124708 AAGAGGCATCTTCAAATCCTTGG - Intronic
1097362046 12:58668825-58668847 ATGAGGCAAAAAGAAAACCTAGG + Intronic
1099291041 12:80776884-80776906 ATGAAACACCTTGAAAAACTGGG - Intergenic
1104299684 12:127553068-127553090 ATGAGGAACCTTGAAAATGTAGG + Intergenic
1106255585 13:28019635-28019657 AGGAGGCAGGTTGCAGACCTGGG - Intronic
1106645280 13:31627738-31627760 ATGAGGAAACTAGAAAACTTAGG + Intergenic
1108033077 13:46257164-46257186 ATGAGGCAGCTTGAAAACCTGGG + Intronic
1110412561 13:75220289-75220311 ATGAGGCTGCTGGATAACCGAGG + Intergenic
1110596024 13:77321537-77321559 ATGGGGCATCTTGAAGACCAAGG - Intronic
1111640429 13:90962852-90962874 ATGTAGCAACTTCAAAACCTTGG + Intergenic
1112780415 13:102894673-102894695 ATGGGCCAAGTTGAAAACCTGGG + Intergenic
1113784333 13:112994590-112994612 ATGTGGCTGCTTGAACAGCTGGG + Intronic
1114451133 14:22826388-22826410 CTGAGGCAGGTGGATAACCTAGG - Intronic
1115022352 14:28697850-28697872 ATGAGGCGGGCTGAAAAGCTGGG - Intergenic
1115866351 14:37751480-37751502 AGGAGGCAGCTGGAAAAGCTGGG - Intronic
1116868901 14:50053295-50053317 ATGATGAAGCTTGATAACTTTGG + Intergenic
1117768384 14:59107317-59107339 AGGAAGCAGCGGGAAAACCTTGG + Intergenic
1118530576 14:66701458-66701480 ATTAGACAGCCTGAATACCTTGG - Intronic
1120972695 14:90221514-90221536 CTGAGGCAGCTGGATCACCTGGG + Intergenic
1124400296 15:29342070-29342092 ATGAGGCAGATTCCAACCCTTGG + Intronic
1127788797 15:62380071-62380093 AGGAAGCAGTTTGAAAACCAGGG + Intergenic
1131587189 15:93708081-93708103 AGGAGGCAGCATGAAACCCCCGG + Intergenic
1132367401 15:101267481-101267503 AAGCAGCAGCTTGAAAAACTTGG + Intergenic
1133805454 16:9123283-9123305 CACAGCCAGCTTGAAAACCTGGG + Intergenic
1134675150 16:16085206-16085228 GTGAAGCAGCAGGAAAACCTGGG - Intronic
1135170258 16:20177627-20177649 ATGAGGCAGGTTGACAAGATGGG + Intergenic
1135915968 16:26605750-26605772 ATGAAGCTGTTTGAAAACCCTGG - Intergenic
1140837231 16:78806462-78806484 CTGAAGCAGCTTGAAAGCCAGGG + Intronic
1146667290 17:34713537-34713559 AACAGGCATCTTTAAAACCTTGG - Intergenic
1147363757 17:39946936-39946958 GTGAGGCAGCTGGACAGCCTCGG + Intergenic
1149659252 17:58325791-58325813 AGGAGTTAGCATGAAAACCTAGG + Intronic
1150889877 17:69135465-69135487 CTGTGGCATCTTGTAAACCTAGG - Intronic
1150958559 17:69889315-69889337 ATAAGGCAGGTTGAAATCCATGG + Intergenic
1151597885 17:75088877-75088899 ATGAGGCGCCCTGAAAACATAGG + Intronic
1154265656 18:12876507-12876529 AAGAGGCAACTAGAAAAGCTAGG + Intronic
1154286044 18:13057600-13057622 ATGAGGAAGCTTCAACTCCTCGG - Exonic
1157987667 18:52458161-52458183 ATGAAGCAGAATGAAACCCTGGG - Intronic
1158283430 18:55852407-55852429 AGCAGGCAGCTTGAATATCTAGG + Intergenic
1159290286 18:66409313-66409335 ATGAGTAGGCTTAAAAACCTTGG + Intergenic
1159422175 18:68235273-68235295 AGGAAGCAGCCTGAAAACCTGGG - Intergenic
1159555784 18:69943054-69943076 ACTTGGCAGCTTGATAACCTTGG + Intronic
1166906991 19:46118383-46118405 TTGAGGCAGCTTGCCCACCTGGG + Intergenic
926012528 2:9420250-9420272 ATGAGGCTGATTAAAAAGCTTGG - Intronic
926229407 2:10991223-10991245 ATGAGGCATCAAGAAAACCCAGG + Intergenic
931905907 2:66843815-66843837 ATTAAGCAGTTTGCAAACCTGGG + Intergenic
932211753 2:69937304-69937326 AAGAGGCAGCTGGAGAAGCTGGG + Exonic
932843056 2:75102212-75102234 ATGTGGCTGCTGGATAACCTAGG - Intronic
934135207 2:88989248-88989270 AGGAGACACCTTGGAAACCTGGG + Intergenic
934235099 2:90224513-90224535 AGGAGACACCTTGGAAACCTGGG - Intergenic
934712054 2:96522760-96522782 AGGAGGCAGGTTGTAAGCCTAGG + Intergenic
935641495 2:105294882-105294904 CAGTGGCAGCTGGAAAACCTTGG + Intronic
938166020 2:129027644-129027666 AACAGGCAGCTTGGAAACCAGGG - Intergenic
939401943 2:141705809-141705831 ATGAGGGATATTTAAAACCTTGG - Intronic
943407037 2:187502174-187502196 ATAAGGTAGCTTCCAAACCTAGG - Intronic
947155165 2:227155003-227155025 ATGACCCACTTTGAAAACCTTGG - Intronic
947382486 2:229558794-229558816 ATGAGCCAGCAAGAAAAGCTGGG + Intronic
948236595 2:236395297-236395319 AGGAGGCAGCTGGGAAGCCTGGG + Intronic
1169822965 20:9734201-9734223 ATTAGGAAAGTTGAAAACCTGGG + Intronic
1170207588 20:13815336-13815358 ATGAAGCAGCTGGATAACCTTGG - Intronic
1170531317 20:17295452-17295474 ATGAGGCAGATAGAAAAATTAGG - Intronic
1172356982 20:34287105-34287127 CTGGAGCAGCTTGGAAACCTGGG - Intronic
1172858150 20:38024466-38024488 ATGAGGCAGAAAGAAAACCTGGG - Intronic
1174383762 20:50174060-50174082 CTGAGGCAGGTGGAATACCTGGG + Intergenic
1174971901 20:55285607-55285629 ATGTGACAGCTTTAAAAGCTCGG - Intergenic
1175532132 20:59681044-59681066 AGGAGGCAGCCTGAAAACCCTGG - Intronic
1175716763 20:61260157-61260179 TAGAGGGAGCCTGAAAACCTAGG - Intronic
1177354598 21:19992139-19992161 ATGAACCAGCTTGAATAGCTGGG + Intergenic
1177447507 21:21216918-21216940 AGCAGGTAGCTTGGAAACCTTGG + Intronic
1178261570 21:31104808-31104830 ATGATGCAGCAAGAAAGCCTTGG - Intergenic
1179028426 21:37699587-37699609 ATTAGGTAGCATGAAAGCCTTGG + Intronic
1179963357 21:44784713-44784735 ATGAGCCAGCTGGAGAACCTGGG + Intronic
1182298362 22:29324117-29324139 AAGAGGCACATTGAAAACATGGG + Intergenic
1184544350 22:45156363-45156385 ATGAGGCAGTTAGAAATCCAGGG + Intergenic
951314977 3:21179033-21179055 AGGAGGCAGCTTTAACAACTGGG + Intergenic
953198972 3:40760133-40760155 ATGATGCATCTTAAAGACCTAGG + Intergenic
953775031 3:45809283-45809305 CTGAGGCAGATGGAACACCTGGG - Intergenic
953975290 3:47377579-47377601 ATGAGGGAGCTGCAAGACCTAGG - Intergenic
956262832 3:67363936-67363958 ATGAGGCAAAATGAAAACCCAGG - Intronic
957428865 3:80076057-80076079 ATGTGCCAGATTGAAAACCTAGG + Intergenic
957436385 3:80182367-80182389 ATGAGGGACCTAAAAAACCTGGG - Intergenic
957780026 3:84807018-84807040 ATGAGGCAACTTGCATCCCTTGG - Intergenic
960775063 3:121241174-121241196 ATGAGGCAGAAAGAAAACTTAGG - Intronic
962121434 3:132564895-132564917 ATGAGGCAAAAAGAAAACCTAGG - Intronic
963008990 3:140751983-140752005 CTGAGGCATCTTAAAAACCTTGG - Intergenic
963170559 3:142246623-142246645 ATGATGCATCTTAAAAACCTAGG + Intergenic
963698009 3:148586399-148586421 ATAAGGTAGGTGGAAAACCTAGG - Intergenic
965351449 3:167616563-167616585 ATGAGGCAGCTAGAAAATGTGGG + Intronic
966047576 3:175571366-175571388 ATGAGGCATTTTGAACTCCTTGG + Intronic
966237914 3:177723027-177723049 ATGAAGGAGCTTAAAAATCTAGG - Intergenic
966269169 3:178083929-178083951 ATGAGTCAGCTTGAAAGGCATGG - Intergenic
966539733 3:181075675-181075697 ATGAGAGAACTTGAATACCTTGG + Intergenic
970251923 4:14125860-14125882 ATGAGGCATTTTGAAAATTTGGG + Intergenic
973794732 4:54413115-54413137 ATGAGGCAAGAAGAAAACCTAGG + Intergenic
980569393 4:134593998-134594020 ATGAGGCAGCTTCAAATGGTTGG - Intergenic
981225993 4:142294880-142294902 ATGAAGCACCTTGTATACCTGGG + Intronic
982874428 4:160627378-160627400 ATGGGGCAGCTTAGAAAACTTGG - Intergenic
983470120 4:168145128-168145150 ATGAGCCAGCTTATCAACCTGGG + Intronic
984162413 4:176269887-176269909 AAGAGGAAGCATGTAAACCTGGG + Intronic
985684897 5:1276712-1276734 CTGTGTCAGCTTGCAAACCTGGG - Intronic
988484128 5:31654346-31654368 AGGAGGCAGCCTAGAAACCTAGG - Intronic
989955195 5:50350960-50350982 ATGAGACAGATTGAAAACAGTGG - Intergenic
994181032 5:96766537-96766559 ATAAGGCAGCTCCAAGACCTGGG + Intronic
997665092 5:135624189-135624211 ATGAGGCATCCTGAGAACCTGGG + Intergenic
998391931 5:141792768-141792790 ATGAGGCAGATTTATACCCTGGG - Intergenic
1000378875 5:160610963-160610985 ATTAGGCAAATTAAAAACCTTGG + Intronic
1001055041 5:168442210-168442232 AAGAGGCAGCTAGAAATCATGGG + Intronic
1001936460 5:175709173-175709195 ATGAAGCATCTTGGAAACCAAGG - Intergenic
1002088376 5:176790194-176790216 ATCAGGCAGCTTGAAAGCAGGGG - Intergenic
1002109024 5:176895517-176895539 ATGAGACAGCTTCTAAATCTTGG + Intronic
1003674134 6:8187641-8187663 ATGAGGCAGCATGTAGACCAAGG - Intergenic
1005967828 6:30740383-30740405 ATGAGGCAGAAAGAGAACCTTGG - Intronic
1009823912 6:68841681-68841703 ATGATGCATCTTGAAGAACTAGG + Intronic
1011262494 6:85483930-85483952 AGGAGGCAGACTGAAAACCCAGG - Intronic
1011440204 6:87379469-87379491 ATGAGGTATCTTGAAAATCTTGG - Intronic
1014934671 6:127373839-127373861 TTGAGGCAGCTTGAAAGCAAAGG - Intergenic
1016079182 6:139834915-139834937 CTTAGGAAACTTGAAAACCTGGG - Intergenic
1018731243 6:166652769-166652791 AAGATGGAGCTTGAAAATCTCGG - Intronic
1019226353 6:170513308-170513330 ATGGGGCTGGTTGAAAAGCTAGG + Intergenic
1022477820 7:30723295-30723317 ATGAGGCAGGATGAAAAGATGGG - Intronic
1022894307 7:34734084-34734106 AGGAGGCAGGTTGACAACTTAGG + Intronic
1024208610 7:47184838-47184860 AGGAGGCATCTAGAACACCTGGG + Intergenic
1024544839 7:50508498-50508520 ATGAGCCAGCTTGATAAGGTCGG - Intronic
1026348413 7:69494807-69494829 AAGAGGAAGCTTGCAGACCTGGG + Intergenic
1027509120 7:79056881-79056903 ATGAGGCAGAATTTAAACCTGGG - Intronic
1028777731 7:94698976-94698998 ATGAGGCATTTGCAAAACCTGGG + Intergenic
1031603774 7:123745823-123745845 ATGAAACAGCTTGAAAAGTTAGG - Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1033495462 7:141889421-141889443 AGAAGGCAGCTTGATAAACTTGG - Intergenic
1034014275 7:147565483-147565505 AAGAGACAGCATGAAAACATTGG + Intronic
1037646487 8:20797018-20797040 ATCAGGAAGCTGGAAAGCCTTGG + Intergenic
1038019333 8:23539600-23539622 ATTAACCAGCTTGGAAACCTTGG + Intronic
1039770450 8:40681078-40681100 ATAAGGCAGCTTGAAGCCCAGGG + Intronic
1043664663 8:82793666-82793688 ATCAGGCAGGTTCAAATCCTAGG - Intergenic
1045550952 8:103171956-103171978 TTGAGGCAGAATCAAAACCTGGG - Intronic
1050526280 9:6549467-6549489 CTGAGGCAGCTTTAGAACCCTGG - Intronic
1052233186 9:26179334-26179356 ATGAGGCAGCTGGTAAAAATTGG + Intergenic
1056189916 9:84174917-84174939 TAGAGGCAGCTTTAAAAACTGGG - Intergenic
1056235236 9:84587859-84587881 TTGTGGCAGCTTGGAAACCAGGG + Intergenic
1057022303 9:91708859-91708881 ATTAGGCAGACTGATAACCTTGG - Intronic
1057036379 9:91814637-91814659 ATGAGGGAGCCTGTAAACGTGGG - Intronic
1058686410 9:107485203-107485225 ATGCAGCAGTTTGAAAACTTTGG + Exonic
1061825151 9:133253355-133253377 ATGAGGCAGAAAGAAAACCCAGG - Intronic
1186837641 X:13453388-13453410 ATGAGGAAGTTTGAAAAGCAGGG + Intergenic
1187213783 X:17254870-17254892 AGGAGGCAGCTTTGAAAACTGGG - Intergenic
1188644140 X:32542995-32543017 CTGAGGTAGCTACAAAACCTGGG - Intronic
1190145196 X:47884636-47884658 ATGGGGCAGCCTGAAAATGTGGG + Intronic
1190992335 X:55565428-55565450 AACAGGCAGATTGAAAACTTAGG + Intergenic
1191030888 X:55969524-55969546 ATGATGCATCTTGAAGAACTAGG + Intergenic
1191718267 X:64207652-64207674 AGAAGGCAGTTTGCAAACCTGGG + Intergenic
1191915878 X:66200731-66200753 ATCATGCAGCCTGACAACCTTGG + Exonic
1192220416 X:69194060-69194082 AAGAGGCAGCAGGCAAACCTTGG + Intergenic
1194424746 X:93722484-93722506 ATGTGGCAGCTCAAGAACCTTGG - Intergenic
1195026381 X:100881746-100881768 ATGAGGCAGGCTTCAAACCTAGG - Intergenic
1195317436 X:103692867-103692889 TGGAGGGAGCTTGAAAACCATGG + Intergenic
1195641798 X:107183565-107183587 ATGAGGCAAAAAGAAAACCTAGG - Intronic
1196645600 X:118114840-118114862 AAATGGCAGATTGAAAACCTTGG + Intronic
1196687086 X:118520376-118520398 ATGAGGCAGTTAGAAAAGCAGGG - Intronic
1200153786 X:153964545-153964567 AGGAGGCAGAGTGAGAACCTGGG + Intronic