ID: 1108037567

View in Genome Browser
Species Human (GRCh38)
Location 13:46307439-46307461
Sequence TAAGTAGAACAGTTGGTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108037567_1108037571 9 Left 1108037567 13:46307439-46307461 CCTAGTACCAACTGTTCTACTTA No data
Right 1108037571 13:46307471-46307493 CGCTTCTTTGTAACTTTGGCTGG No data
1108037567_1108037569 5 Left 1108037567 13:46307439-46307461 CCTAGTACCAACTGTTCTACTTA No data
Right 1108037569 13:46307467-46307489 TTTCCGCTTCTTTGTAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108037567 Original CRISPR TAAGTAGAACAGTTGGTACT AGG (reversed) Intergenic
No off target data available for this crispr