ID: 1108038727

View in Genome Browser
Species Human (GRCh38)
Location 13:46320073-46320095
Sequence AAGAAAAAGGAGGAAGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108038720_1108038727 10 Left 1108038720 13:46320040-46320062 CCTCTTAGAGCTAAGGAAGAAGA No data
Right 1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108038727 Original CRISPR AAGAAAAAGGAGGAAGAGGC CGG Intergenic
No off target data available for this crispr