ID: 1108044262

View in Genome Browser
Species Human (GRCh38)
Location 13:46368033-46368055
Sequence CAGTGGCTATGAAGGCAAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 342}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108044262_1108044266 17 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1108044262 13:46368033-46368055 CCAACTTGCCTTCATAGCCACTG 0: 1
1: 0
2: 0
3: 18
4: 342
Right 1108044266 13:46368073-46368095 CCCAGACTCTTGCTTTATGTTGG 0: 1
1: 0
2: 2
3: 12
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108044262 Original CRISPR CAGTGGCTATGAAGGCAAGT TGG (reversed) Exonic
900037376 1:427460-427482 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
900059006 1:663201-663223 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
900116368 1:1029389-1029411 CAGTGTCTATGCAGGCAGGTGGG + Intronic
900116375 1:1029420-1029442 CAGTGTCTATGCAGGCAGGTAGG + Intronic
900667073 1:3822702-3822724 CAGTGACTCAGCAGGCAAGTGGG - Intronic
901578730 1:10222623-10222645 AAGTGCCTTTGAGGGCAAGTGGG + Intronic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
907342716 1:53748297-53748319 CAATGGCTAAGAATGCAAGGAGG + Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909520370 1:76561193-76561215 CAGAGGCTAGGAAGGATAGTGGG + Intronic
909726674 1:78844718-78844740 CAGTGGCTATGAAGAACAGGGGG + Intergenic
910351100 1:86298512-86298534 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
910634906 1:89396867-89396889 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
910905515 1:92173480-92173502 CAGGGGATAGGAAGGCAAGTAGG - Intronic
913417209 1:118621968-118621990 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
916382521 1:164228218-164228240 CAGTGGCTATGAGGGTGGGTTGG - Intergenic
917667519 1:177239700-177239722 CTGTGAATGTGAAGGCAAGTGGG - Intronic
917668867 1:177252726-177252748 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
917718964 1:177767778-177767800 TAGTGGGTATGAAGTCAAGGAGG + Intergenic
918989313 1:191677508-191677530 CAGAGGCTAGGAAGGATAGTGGG - Intergenic
919098260 1:193062228-193062250 CAGTGGTTTAGAAGGCAATTGGG - Intronic
920274032 1:204790574-204790596 CAGTGGGGATGAAGGGAACTAGG - Intergenic
922726206 1:227924129-227924151 TCGTGGGTGTGAAGGCAAGTGGG - Exonic
923475150 1:234325055-234325077 CAGGGGCTATGAGAGCCAGTGGG + Intergenic
924112121 1:240710614-240710636 CAGAGGCTAGGAAGGGGAGTGGG - Intergenic
924559859 1:245149060-245149082 CAGTGGCTCTGTCGGCATGTTGG + Intergenic
924692067 1:246362135-246362157 CAGTATCTATGAAGTGAAGTAGG - Intronic
924825201 1:247531560-247531582 CTGTGGCTCTGCAGGCAAGCTGG - Exonic
1064218801 10:13421962-13421984 CAGTGCCTCAGAATGCAAGTGGG - Intergenic
1064773584 10:18750850-18750872 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
1065897280 10:30175111-30175133 AAGAGGGTATGAAGGGAAGTTGG - Intergenic
1066192648 10:33070037-33070059 CAGAGGCTATGAGGGCAGGGTGG - Intergenic
1066491613 10:35900085-35900107 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
1066685184 10:37975096-37975118 CAGAGGCTGCGAAGGGAAGTAGG + Intronic
1067359604 10:45566419-45566441 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1067662324 10:48245708-48245730 CAGAGGCCATGTAGACAAGTGGG - Intronic
1068307937 10:55239000-55239022 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1068478454 10:57558894-57558916 TAGAGGCTGAGAAGGCAAGTGGG - Intergenic
1068542432 10:58310336-58310358 CAGAGGCTAGGAAGGGAAGTGGG + Intergenic
1071113370 10:82189112-82189134 CAGAGGCTGGGAAGGGAAGTGGG - Intronic
1073753242 10:106553644-106553666 CACTGGCTTTGAAAACAAGTAGG - Intergenic
1074954721 10:118377373-118377395 TAGAGGCTAAGAAGGCAAATGGG - Intergenic
1075342654 10:121659917-121659939 CAGTTCCTATGGAGGCAAGGTGG + Intergenic
1076377179 10:129998994-129999016 CAGGGGCTAGGAAGGATAGTGGG + Intergenic
1076964102 11:65383-65405 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1077588052 11:3469683-3469705 CAGTGGCCATCAAGGCAGGATGG - Intergenic
1077934418 11:6768597-6768619 CATAGGCCATGAAGGCCAGTAGG + Exonic
1077935904 11:6785376-6785398 CATAGGCCATGAAGGCCAGTAGG - Exonic
1078745925 11:14114204-14114226 CAGAGGCTGGGAAGGCTAGTAGG - Intronic
1079625362 11:22610770-22610792 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1079710833 11:23680424-23680446 CTGCAGCTATGAAGGGAAGTGGG + Intergenic
1080965015 11:37204344-37204366 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
1080990084 11:37522220-37522242 CAGAGGCTAAGAAGGGTAGTTGG + Intergenic
1082219047 11:49610363-49610385 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1082704812 11:56480312-56480334 CAGTGGCTATGTAGACAAAAAGG + Intergenic
1083261741 11:61526875-61526897 AAGTGGCTGGGAAGGCAGGTGGG + Intronic
1083635929 11:64120990-64121012 TAGTGGCTAGGAAGGCATCTGGG + Intronic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1084243748 11:67841321-67841343 CAGTGGCCATCAAGGCAGGCTGG - Intergenic
1084828939 11:71753251-71753273 CAGTGGCCATCAAGGCAGGCTGG + Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085991153 11:81846221-81846243 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1086630604 11:89014511-89014533 CAGAGGCTGGGAAGGGAAGTGGG + Intronic
1087218427 11:95519757-95519779 CACTGTGTATGAAGGCAAGTAGG + Intergenic
1087532338 11:99400170-99400192 CAGAGGCTAAGAAGGGTAGTGGG - Intronic
1087718177 11:101632734-101632756 CCGTGGCTTTGAAGTCAAGTGGG - Intronic
1089761550 11:120728911-120728933 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1090137876 11:124217971-124217993 CAGAGGCTGTGAAGGGTAGTAGG - Intergenic
1090513985 11:127405172-127405194 AAGTGGCTATCAAGGGAATTAGG + Intergenic
1090755286 11:129785045-129785067 CAGTGGCTATGATGGTCACTGGG - Intergenic
1091349702 11:134883093-134883115 CAGGGGATGTGAAGGGAAGTCGG + Intergenic
1092298206 12:7219344-7219366 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
1092414299 12:8278436-8278458 CAGTGGCCATCAAGGCAGGCTGG - Intergenic
1093476002 12:19555044-19555066 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1093864466 12:24208397-24208419 TAGTGACTATAAAGGTAAGTTGG - Intergenic
1094330797 12:29290844-29290866 CAGAGGCTGGGAAGGCAAGTGGG + Intronic
1094449544 12:30570032-30570054 CAGAGGCTGGGAAGGCTAGTTGG - Intergenic
1095134282 12:38579669-38579691 CAGAGGCTGGGAAGGGAAGTGGG + Intergenic
1095408812 12:41899399-41899421 CAGAGACTAGGAAGGAAAGTGGG + Intergenic
1095582185 12:43813142-43813164 GTATGACTATGAAGGCAAGTGGG - Intergenic
1096014308 12:48254402-48254424 CAGAGGCTAGGAAGGGTAGTTGG + Intergenic
1096418817 12:51438282-51438304 TAGAGGCTAGGAAGGCAAGGGGG - Intronic
1096768463 12:53914429-53914451 CAGTAGCCGTGATGGCAAGTTGG - Intergenic
1097296180 12:57965540-57965562 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1098047721 12:66419289-66419311 CAGAGGCTAGGAAGGGTAGTGGG + Intronic
1098165070 12:67687834-67687856 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1098396482 12:70023761-70023783 CAGAGGCTGGGAAGGCGAGTTGG + Intergenic
1100767920 12:97888005-97888027 CAGTGACTATGAATGTGAGTTGG + Intergenic
1101272182 12:103159417-103159439 CTGAGGCTATGATGGTAAGTTGG + Intronic
1104073248 12:125366016-125366038 CAGAGGCTGGGAAGGGAAGTGGG - Intronic
1104102608 12:125627814-125627836 CAGAGGCTAGGAAGGGCAGTGGG - Intronic
1104403728 12:128499545-128499567 CAGAGGCTAAGAAGGGTAGTCGG - Intronic
1104622013 12:130321684-130321706 CATTGGATCTGAGGGCAAGTGGG + Intergenic
1105370128 13:19794919-19794941 CAGTGGGGAGGTAGGCAAGTGGG + Intergenic
1105790088 13:23790115-23790137 GACTGGGTCTGAAGGCAAGTAGG + Intronic
1106005782 13:25769175-25769197 CAGTGGGAATGAAGGCATGCAGG + Exonic
1107707966 13:43125700-43125722 CAGAGGCTGGGAAGGGAAGTCGG + Intergenic
1107898653 13:44990216-44990238 GAGAGGCTAGGAAGGCAGGTCGG - Intronic
1108044262 13:46368033-46368055 CAGTGGCTATGAAGGCAAGTTGG - Exonic
1110664659 13:78102364-78102386 CAGCTGCTCTGAAGGGAAGTTGG - Intergenic
1110689633 13:78417100-78417122 CAGTGGCCATGAAGGAATGGAGG + Intergenic
1110806371 13:79758790-79758812 CAGAGGCTAAGAAGGGTAGTGGG - Intergenic
1111426346 13:88089246-88089268 CAGTGGCTGGGAAGGGTAGTGGG - Intergenic
1112109222 13:96276097-96276119 CAGAGGCTATCAAGGCATGCTGG - Intronic
1112569888 13:100584468-100584490 CAGAGGCTAGGAAGGGTAGTAGG + Intronic
1112713170 13:102153705-102153727 CAGAGGCTGGGAAGGCAAGGAGG - Intronic
1115060656 14:29185794-29185816 CACTGGCTATGATGACGAGTGGG - Intergenic
1115663225 14:35518345-35518367 CAGTAGATAAAAAGGCAAGTTGG - Intergenic
1116648271 14:47558070-47558092 CAGTGAAAATGAAGGCAAGTGGG + Intronic
1118263561 14:64271261-64271283 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1119544970 14:75464972-75464994 GAGTGGCTATGAAGACCAGAGGG - Intronic
1120017528 14:79490659-79490681 CAGAGGCTGGGAAGGGAAGTGGG + Intronic
1120668969 14:87342085-87342107 CAGAGGCTAGGAAGGATAGTTGG + Intergenic
1121696242 14:95914577-95914599 GAGTGGCTATGTGGACAAGTAGG + Intergenic
1121872963 14:97426287-97426309 CAGGGGCTGTGATGGCATGTTGG - Intergenic
1122429821 14:101633295-101633317 CAGTGGGTATGAACTCCAGTGGG + Intergenic
1122654997 14:103252447-103252469 CAGAGGCTAAGAAGGGTAGTGGG + Intergenic
1123767389 15:23495143-23495165 CAGAGGCTGGGAAGGGAAGTGGG + Intergenic
1124554654 15:30713147-30713169 CAGGGGCTGGGAAGGGAAGTGGG - Intronic
1124676594 15:31692533-31692555 CAGGGGCTGGGAAGGGAAGTGGG + Intronic
1125253055 15:37728520-37728542 CAGTGGGAATTAAGCCAAGTGGG - Intergenic
1126293981 15:47116656-47116678 CAGAGTCTATGAAGGGTAGTGGG - Intergenic
1128683233 15:69666366-69666388 CAGTGGCCAGGAAAGCAAGCCGG - Intergenic
1129078983 15:73023115-73023137 CAGAGGGTAAGAAGGCAGGTGGG - Intergenic
1129834945 15:78696551-78696573 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1131235351 15:90692123-90692145 CAGTGGTTATGAACACAGGTAGG + Intergenic
1132444449 15:101899800-101899822 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1133355500 16:5133654-5133676 CAGTGGCCATCAAGGCAGGCTGG - Intergenic
1133902056 16:9985689-9985711 CAGAGGCTAGGAAGGGTAGTTGG + Intronic
1134976950 16:18578309-18578331 TAGAGGCTAGGAAGGAAAGTGGG + Intergenic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135267486 16:21040050-21040072 CAGTGACAATAAAGGCAAGAAGG + Intronic
1136045404 16:27611179-27611201 CAGAGTCTATACAGGCAAGTTGG + Intronic
1136271229 16:29149538-29149560 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1140142126 16:72268184-72268206 CAGAGGCTATGAAGGGTAGTGGG - Intergenic
1141110279 16:81266105-81266127 CAGGGGCTAGGAATGAAAGTAGG - Intronic
1141700637 16:85640500-85640522 CACTGGCTTTGCAGGCAAGAGGG + Intronic
1142868328 17:2804737-2804759 CAGGGGCTATGGAGCCACGTTGG + Intronic
1143618371 17:8067061-8067083 AAGTGGCTATGCTGGGAAGTTGG + Intergenic
1143943678 17:10570407-10570429 CAGAGGCTGGGAAGGGAAGTAGG - Intergenic
1144213088 17:13031690-13031712 CAGTGGCCAGGAAGGTAAGATGG + Intergenic
1147568392 17:41551773-41551795 CAGTGGCAATGAAGGAACGAGGG - Intergenic
1151737443 17:75953044-75953066 CTGTGGCTATGAATGCAAAAGGG + Intronic
1152221481 17:79070711-79070733 CAGTGGGTATAAAGGTGAGTCGG + Intergenic
1153267705 18:3287185-3287207 CAGAGGCTAGGAAGGGTAGTCGG - Intergenic
1153430589 18:5012179-5012201 CAGAGGCTAGGAAGGGTAGTTGG + Intergenic
1155108955 18:22695090-22695112 CAGTGGTTATTAAGAAAAGTGGG - Intergenic
1155921309 18:31605849-31605871 CAGAGGCTGTGAAGGACAGTGGG + Intergenic
1155932525 18:31722677-31722699 CAGATGAAATGAAGGCAAGTAGG - Intergenic
1158517992 18:58146693-58146715 CAGTGGCTAGGGAGGCAGGCAGG + Intronic
1158613384 18:58963394-58963416 CAGTGGCAGTGAAGGAAAGTGGG + Intronic
1158870180 18:61679115-61679137 CAGAGGCTAAGAAGGATAGTGGG + Intergenic
1159202858 18:65209757-65209779 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1159225299 18:65525746-65525768 CAATGACTATGAAGGGTAGTGGG + Intergenic
1160433950 18:78831967-78831989 CAGTGGCTGAGAAGGGAAGGAGG - Intergenic
1160640905 19:135015-135037 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1161483230 19:4521279-4521301 CTGTGGCTATAAAGTCAAGGTGG + Intergenic
1167059558 19:47135327-47135349 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1167305320 19:48704996-48705018 CCCTGGTTAAGAAGGCAAGTGGG + Exonic
1168588434 19:57613707-57613729 CAGTGGCTATGGAGGGATGCTGG - Intergenic
926025827 2:9543755-9543777 CAGAGGCTGAGAAGGGAAGTGGG + Intronic
926192765 2:10741176-10741198 CAGTTTCTGTGAAGCCAAGTTGG + Intronic
926900534 2:17747071-17747093 CAAAGGCTATGTAGACAAGTAGG + Intronic
926967618 2:18432532-18432554 TGATGGCTATTAAGGCAAGTTGG - Intergenic
928384797 2:30857972-30857994 CAGAGGCTGGGAAGGGAAGTTGG + Intergenic
928768494 2:34676629-34676651 CAGAGGCTAGGAAGGGTAGTAGG + Intergenic
928996719 2:37300363-37300385 CAGAGGCTCTGAAGGGTAGTGGG + Intronic
930560888 2:52958632-52958654 CAGAGGCTACGAAGGGAATTTGG + Intergenic
930779050 2:55204920-55204942 CAGAGGCTATGAAGGGTAGTAGG + Intronic
931001421 2:57788360-57788382 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
932048644 2:68376919-68376941 CAGAGGCCAGGAAGGGAAGTGGG - Intronic
932785990 2:74604313-74604335 CACTGGCTTGGAAGACAAGTAGG - Intronic
933347572 2:81108560-81108582 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
935035486 2:99368181-99368203 CAGAGGCTAAGAAGGTAAGGAGG + Intronic
935883305 2:107588623-107588645 CATGTGCTATGAAGGCAAGGTGG - Intergenic
936994260 2:118397026-118397048 CAGTGGCTGGGAAGGGTAGTGGG - Intergenic
939575813 2:143893369-143893391 CTGTGTCTATGGAGACAAGTCGG - Intergenic
940606844 2:155935594-155935616 CAAAGTCTATGAAGGCAAATTGG - Intergenic
940626718 2:156184590-156184612 CAATGGCTTTGAAAGCAACTAGG - Intergenic
940685073 2:156838555-156838577 CAATGGCTATGTAGACAAGGTGG + Intergenic
943320055 2:186434614-186434636 GAGTGGCTGAGAATGCAAGTAGG + Intergenic
945812869 2:214569621-214569643 AAGTGGCCAGGAAGACAAGTTGG - Intronic
946170000 2:217889444-217889466 CAGGGGCTAAAAAGGCAAATAGG + Intronic
947558804 2:231126511-231126533 CTGTGCTTATGAAGGCAGGTAGG + Intronic
947777020 2:232721096-232721118 CAGTGCCTCTGAAGGAATGTGGG - Intronic
948106069 2:235414685-235414707 GAGTGGGTATGAAGGGAACTGGG + Intergenic
1168760373 20:346659-346681 TAGCGGCTCTCAAGGCAAGTGGG + Intergenic
1170085908 20:12531309-12531331 CAGTGCCAATGAAGGCAATAAGG - Intergenic
1170335015 20:15260285-15260307 CAGAAGCTATGAAAGGAAGTGGG - Intronic
1170857235 20:20068482-20068504 CACTGGCTATCAAGGAAAGGAGG - Intronic
1172383420 20:34515752-34515774 GGGAGGGTATGAAGGCAAGTGGG - Intergenic
1172557616 20:35856106-35856128 CAGAGGCTAGGAAGGGTAGTAGG - Intronic
1173038489 20:39436039-39436061 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1177246490 21:18531810-18531832 CAGAGGCTGGGAAGGGAAGTAGG + Intergenic
1178547751 21:33507386-33507408 CAGAGGCTAGGAAGGGTAGTGGG + Intronic
1179131800 21:38644055-38644077 AAGTGGCTATGAAGGCCTCTAGG - Intronic
1179749049 21:43458110-43458132 CAGAGGCTGAGAAGGGAAGTCGG - Intergenic
1181503812 22:23337486-23337508 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181708808 22:24667706-24667728 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1184182631 22:42840960-42840982 CAGTTGCGATGCATGCAAGTCGG - Exonic
1184462687 22:44648341-44648363 AGGTGGCCATGTAGGCAAGTGGG + Intergenic
1184679393 22:46062004-46062026 CAGCGGCTCTGAAGGCAGGGAGG - Intronic
1185034970 22:48469722-48469744 CAGAGGCTGGGAAGGGAAGTCGG - Intergenic
949534190 3:4983179-4983201 CAGTGGCTATGGAGGAGAATCGG + Exonic
951309812 3:21110839-21110861 CAGAGCCTATGAAGGGGAGTAGG - Intergenic
951904895 3:27695382-27695404 CAGTGGCTGGGAAGGGTAGTGGG + Intergenic
952536411 3:34314617-34314639 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
953493202 3:43366623-43366645 CAGTGGCTCTGCAGCAAAGTTGG + Exonic
956537908 3:70299363-70299385 CAGTGGCTATCTATGCATGTGGG + Intergenic
957059327 3:75469312-75469334 CAGTGGCCATCAAGGCAGGCTGG - Intergenic
957506850 3:81133048-81133070 CATTGGCTATGAAAAAAAGTTGG - Intergenic
958023480 3:88024037-88024059 CAGAGGCTGTAAAGGTAAGTGGG + Intergenic
959548134 3:107621794-107621816 CCGTGGCACTGAAGGCCAGTAGG - Intronic
961294077 3:125870074-125870096 CAGTGGCCATCAAGGCAGGCTGG + Intergenic
961891852 3:130137059-130137081 CAGTGGCCATCAAGGCAGGCTGG - Intergenic
962262899 3:133926348-133926370 CAGTGGCCATAATGACAAGTAGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
964208289 3:154199212-154199234 CAGAGGCTAGGAAGGGTAGTCGG - Intronic
964810328 3:160656494-160656516 CAGAGGCTGTGAAGGGTAGTAGG + Intergenic
965143953 3:164873850-164873872 CAGAGGCTTTGATGGCTAGTGGG - Intergenic
965438501 3:168683323-168683345 CAGTGGCTGAGAAGGGTAGTGGG + Intergenic
966302523 3:178495381-178495403 TAGTGGAGATGAAGCCAAGTGGG - Intronic
966338009 3:178892480-178892502 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
966583905 3:181599988-181600010 CAGAGGCTGGGAAGGCAAGTGGG - Intergenic
966633287 3:182103113-182103135 CAGTGACTAAGAAGGCAATGGGG - Intergenic
966893625 3:184426292-184426314 GAGTGGCTATGACTGCAAGAAGG + Intronic
969003236 4:3999495-3999517 CAGTGGCCATCAAGGCAGGCTGG - Intergenic
969750789 4:9109036-9109058 CAGTGGCCATCAAGGCAGGCTGG + Intergenic
969810690 4:9645324-9645346 CAGTGGCCATCAAGGCAGGCTGG + Intergenic
971452868 4:26816409-26816431 CAGTGGATAAGAAAACAAGTGGG + Intergenic
972350517 4:38232146-38232168 AAGTGGCTATGACTGCAAGATGG - Intergenic
972800047 4:42464925-42464947 CAGTGGCAATGAAGGCCTGCAGG - Exonic
972901515 4:43690876-43690898 CAGTGGCTAGGAAGGGTAATGGG - Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973015396 4:45131063-45131085 AAGTGGCAATGAAGGGAAGCTGG - Intergenic
973053233 4:45620924-45620946 TTGTGGATATGAATGCAAGTAGG - Intergenic
973166749 4:47087435-47087457 TAGTGGCTCTGCAGGCAAGGCGG - Intronic
973737968 4:53891151-53891173 CAGAGGCAAGGAGGGCAAGTTGG + Intronic
973916963 4:55643632-55643654 CAGAGGCTGGGAAGGCTAGTAGG - Intergenic
973967118 4:56174443-56174465 CAGAGGCTAAGAAGGGAAGCAGG - Intronic
975063344 4:70032724-70032746 CAGTGGGTATGAAAGAATGTAGG + Intronic
975065290 4:70055059-70055081 CAGTGGGTATGAAAGAATGTAGG + Intronic
976498093 4:85754071-85754093 CAGAGGCCAGGAAGGAAAGTGGG - Intronic
976561823 4:86510869-86510891 CAGAGGCTAGGAAGAAAAGTGGG + Intronic
977623586 4:99164941-99164963 CAGTGGCTGGGAAGGGTAGTGGG - Intergenic
977794433 4:101145620-101145642 CAGAGGCTAAGAAGGGTAGTTGG + Intronic
978097561 4:104796882-104796904 CAGAGGCTAGGAAGGACAGTTGG - Intergenic
979184956 4:117776599-117776621 TAGAGGCTATGAAGGATAGTTGG + Intergenic
980308311 4:131093990-131094012 CAGAGACTAAAAAGGCAAGTTGG + Intergenic
981791907 4:148547468-148547490 CTGTGGCTAAGAAAGAAAGTAGG - Intergenic
983970956 4:173873691-173873713 CAGAGGCTAGGAAGGATAGTGGG + Intergenic
985167776 4:187115833-187115855 CTGTGCCTATCAAAGCAAGTGGG + Intergenic
986996030 5:13608337-13608359 CAGAGGCTAGGAAGGGTAGTTGG + Intergenic
987015224 5:13811071-13811093 CAGAGGCTAGGAAGGGGAGTGGG + Intronic
987503513 5:18743195-18743217 CAGTGGCTCTGAAAGAAAGAAGG - Intergenic
989192687 5:38686614-38686636 CAGTTCCTATGCAGGCAAATTGG - Intergenic
990080795 5:51911394-51911416 CAGTGTCTATGAAAGCTAATAGG + Intergenic
990700468 5:58469626-58469648 CAGAGGCTACGAAGGGTAGTGGG - Intergenic
990963653 5:61421261-61421283 CAGAGGCTAGGAAGAAAAGTGGG - Intronic
991906571 5:71519463-71519485 CAGAGGCTAGGAAGGCAAGAGGG - Intronic
991956430 5:71999783-71999805 CACTGGACATGATGGCAAGTGGG - Intergenic
992349885 5:75917658-75917680 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
992587793 5:78259361-78259383 CAGAGGCTGAGAAGGGAAGTGGG + Intronic
992878173 5:81078400-81078422 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
993605994 5:89991241-89991263 CATTGGAAATGACGGCAAGTGGG + Intergenic
994001159 5:94781300-94781322 CAGGTGCTATGAAGGCAGGATGG + Intronic
994147298 5:96409685-96409707 CAGGGGCTCTGAAGACAAGTGGG + Intronic
997002577 5:129779764-129779786 CAGAGGCTGAGAAGGGAAGTGGG + Intergenic
997060461 5:130495357-130495379 CAGAGGCTGGGAAGGGAAGTAGG + Intergenic
997109987 5:131064491-131064513 CAGTGGCTAGAAAGGCAGGTAGG + Intergenic
997520792 5:134524017-134524039 CTTTGGCTTTGAAGGCACGTGGG - Intergenic
1001071802 5:168592118-168592140 CAGTGGCTGTGAAGGTAAACAGG - Intergenic
1001910511 5:175513751-175513773 CAGTGGTGATGAGGGCAAGGGGG + Intronic
1001953925 5:175835047-175835069 CTGAGGCTGTGAAGGCAAGCAGG + Intronic
1002010012 5:176271563-176271585 CAGAGGCTAGGAAGGGGAGTAGG + Intronic
1002216722 5:177640741-177640763 CAGAGGCTAGGAAGGGGAGTAGG - Intergenic
1002736445 5:181391406-181391428 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1002748252 6:83418-83440 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1003708539 6:8562645-8562667 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1005036639 6:21561389-21561411 CAGAGGCTACGAAGGGCAGTGGG - Intergenic
1006208364 6:32370819-32370841 CAGTGGCTATGAAGGATCGGGGG + Intronic
1006701972 6:35982319-35982341 CAGTCCCTATGCATGCAAGTTGG + Intronic
1010026220 6:71220490-71220512 CAGTCTCTATGCAGGGAAGTTGG + Intergenic
1010324401 6:74548480-74548502 CAGAGGCTAAGAAGGGTAGTGGG - Intergenic
1010839359 6:80629989-80630011 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1011030091 6:82913047-82913069 CAGTGGCTATGCAATCCAGTGGG + Intronic
1011306048 6:85927999-85928021 CAGAGGCTAGGAAGGGGAGTGGG - Intergenic
1012028969 6:94034046-94034068 AAATGGCTATGTAGACAAGTAGG - Intergenic
1012627475 6:101421408-101421430 CAGTGGGAATGAAGGCAATGTGG + Intronic
1014009540 6:116460351-116460373 GAGTAGTTAAGAAGGCAAGTTGG + Intergenic
1014703768 6:124721699-124721721 CACTGGCTGTGAAAGGAAGTGGG - Intronic
1016145115 6:140661325-140661347 CGTAGGCTAGGAAGGCAAGTTGG - Intergenic
1017027717 6:150196248-150196270 CAGATGCTATAAAGGCAAGCAGG - Intronic
1018251681 6:161877833-161877855 CAGTTGCTAGGATGGCATGTGGG + Intronic
1019130923 6:169873871-169873893 CAGTGGCTGAGAAGGGTAGTGGG - Intergenic
1019241543 6:170666935-170666957 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1020322190 7:6947599-6947621 CAGTGGCCATCAAGGCAGGCTGG - Intergenic
1021905795 7:25331825-25331847 CAGGGGCTTTGAAGGCAAACAGG + Intergenic
1023622026 7:42083193-42083215 CAGAGGCTAGGAAGGATAGTGGG - Intronic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1024956993 7:54932963-54932985 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1025065675 7:55853519-55853541 CAGAGGCTAAGAAGGGTAGTGGG + Intronic
1025952357 7:66155407-66155429 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1030629660 7:111881920-111881942 CAGTGGCTGGGAAGGGTAGTGGG + Intronic
1031116109 7:117670526-117670548 CTGTGCCTATGAAGACAAGCTGG - Intronic
1032066083 7:128772358-128772380 CAGTAGCTTTGTAGGCAAGAAGG + Intergenic
1033844179 7:145412361-145412383 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
1034276854 7:149827656-149827678 CTGTGGCTGAGAAGGCAAGATGG + Intergenic
1035506573 8:141161-141183 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1035582120 8:747009-747031 CAGTGGCTAGGAAGGGAAATGGG + Intergenic
1037353679 8:17994180-17994202 CAGAGGCTATGAAAGGTAGTAGG - Intronic
1039675039 8:39653971-39653993 CAGAGGCTGGGAAGGGAAGTGGG - Intronic
1039979916 8:42400449-42400471 CAGAGGCTAAGAAATCAAGTAGG - Intronic
1040632744 8:49235038-49235060 CAGAGGCTTTGAAGGGTAGTAGG - Intergenic
1041158090 8:55008672-55008694 CAGTGACTAACAAGGCAACTTGG - Intergenic
1041876547 8:62694235-62694257 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1042082003 8:65064479-65064501 CAGAGGCTAGGAAGGGTAGTTGG - Intergenic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1044189544 8:89298458-89298480 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1044192516 8:89335723-89335745 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1046166496 8:110443256-110443278 CAGAGGCTAGGAAGGGTAGTTGG - Intergenic
1046859470 8:119074138-119074160 CAGAGGCTAGGAAGGGGAGTGGG + Intronic
1047099876 8:121665232-121665254 AAGTGGCTTTGAAGACAAGCAGG + Intergenic
1052927970 9:34033456-34033478 CAGAGGCTAGGAAGGGTAGTGGG + Intronic
1055310552 9:74975018-74975040 GAGTGGCTATGAAGAGAGGTTGG + Intergenic
1055744454 9:79427297-79427319 CAGTGGCAATGAGGGCTTGTGGG + Intergenic
1055937213 9:81614361-81614383 CTTTGGTTATGTAGGCAAGTGGG - Intronic
1058248354 9:102659477-102659499 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1058499852 9:105602384-105602406 TAGTGGTTCTCAAGGCAAGTGGG - Intronic
1060388788 9:123259799-123259821 AAGAGACTATGAAGCCAAGTAGG + Intronic
1061539340 9:131269337-131269359 CATAGGCGATGAAGACAAGTGGG - Intronic
1203601735 Un_KI270748v1:16169-16191 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1187487043 X:19714179-19714201 CAGAGGCTAGGAAGGGTAGTGGG + Intronic
1188212085 X:27439078-27439100 AAGTAGGTATGAAGGCAACTTGG - Intergenic
1188625508 X:32279654-32279676 CAGAGGCTGTGAAGGGTAGTGGG + Intronic
1188747384 X:33862771-33862793 CAGAGGCTAGGAAGGATAGTGGG - Intergenic
1191130520 X:57003563-57003585 CAGAGGCTACAAAGGGAAGTGGG - Intergenic
1191650833 X:63536381-63536403 CAGAGGCTAGGAAGGATAGTGGG + Intergenic
1192187757 X:68964311-68964333 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
1192301193 X:69904676-69904698 CAGAGGCTGGGAAGGCTAGTGGG - Intronic
1192824953 X:74685577-74685599 CAGAGGCTAAGAAGGGTAGTGGG - Intergenic
1193318211 X:80089570-80089592 CAGGGGCTAAGAAGGGTAGTGGG + Intergenic
1193642806 X:84032717-84032739 CAGTGGCTGGGAAGGGCAGTGGG - Intergenic
1195210851 X:102651582-102651604 CTGGGCCTCTGAAGGCAAGTAGG + Exonic
1195221143 X:102746161-102746183 CTGGGCCTCTGAAGGCAAGTGGG + Exonic
1195709235 X:107760697-107760719 CAGTTGCTATCAATGCCAGTAGG + Intronic
1195713064 X:107790588-107790610 CAGTGTGTATGAAGGCATGAAGG - Intronic
1196401384 X:115320517-115320539 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1196568688 X:117239837-117239859 AATTGGCTATGTAGGCAAGGGGG + Intergenic
1197101276 X:122658506-122658528 CAGAGGCTAGGAAGGGTAGTAGG + Intergenic
1197547270 X:127840349-127840371 CAGTGGCTAGGAAGGACAGTTGG + Intergenic
1197642335 X:128980783-128980805 CAGAGGCTGGGAAGGGAAGTGGG + Intergenic
1197876058 X:131108382-131108404 CAGAGGCTGTAAAGGGAAGTGGG - Intergenic
1198045325 X:132896109-132896131 CAGAGGCTGGGAAGGGAAGTGGG + Intronic
1198530178 X:137544592-137544614 CAGTTGGTATGATGGCAGGTGGG + Intergenic
1198612797 X:138420605-138420627 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1198981361 X:142399958-142399980 CAGAGGCTGTGAAGGGTAGTAGG - Intergenic
1199108448 X:143900895-143900917 CAGAGGCTAAGAAGGATAGTGGG + Intergenic
1199933986 X:152553331-152553353 TAGTGGCTCTGCAGGCAAGGCGG + Intergenic