ID: 1108044621

View in Genome Browser
Species Human (GRCh38)
Location 13:46372004-46372026
Sequence GGGAGGTGGCCAAAATCCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108044621 Original CRISPR GGGAGGTGGCCAAAATCCCA GGG Exonic
900493171 1:2963070-2963092 GGCAGGAGGCCAACATCCCTTGG - Intergenic
900985121 1:6068777-6068799 GGGAGGAGGCCAGAGTCACAGGG - Intronic
901042551 1:6374231-6374253 GGGAGGTGGCCAAATGGCCCTGG + Intronic
902040086 1:13486184-13486206 GGGAGGCGGCCATAAGCCAAAGG - Intronic
902296925 1:15474047-15474069 GGGTGGGGGGCAGAATCCCATGG - Intronic
904466678 1:30712270-30712292 GGGAGGTGGCCGAGATCTCAGGG + Exonic
904593566 1:31628765-31628787 GGGAGGTGACCAGGATGCCAAGG + Intronic
905345512 1:37308667-37308689 GGGCACTGGCCAAAGTCCCAAGG - Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906323729 1:44831723-44831745 GGGAGGGAGCCAAACTCCAAGGG - Exonic
913214547 1:116609634-116609656 CCGAGGTGGAAAAAATCCCATGG + Intronic
914007752 1:143747734-143747756 GGGAGCTGACCAAATTGCCAAGG + Intergenic
921070992 1:211657188-211657210 TGGAGGTGGCCAAACTGCCATGG + Intergenic
921649232 1:217657210-217657232 GGGAGGTGGCTAAAACTCTAGGG - Intronic
922772791 1:228196972-228196994 GGGATGTGGCCACAAGCCCAGGG - Intergenic
923862151 1:237902296-237902318 TGGAAGTGGCCAGAATTCCAAGG - Intergenic
1066745060 10:38600430-38600452 GGCAGGGGGGCAAAAACCCAGGG - Intergenic
1067431789 10:46250177-46250199 GGCAGGTGGTCTAAAGCCCAGGG + Intergenic
1067479222 10:46584498-46584520 TGGAGGTCGCCAAACTCCGAGGG - Exonic
1067615517 10:47757303-47757325 TGGAGGTCGCCAAACTCCGAGGG + Intergenic
1069844719 10:71362964-71362986 GGGAGGTTGCAAAGAGCCCATGG - Exonic
1070843803 10:79506233-79506255 AGGAGGTGGCTGAAGTCCCAGGG + Intergenic
1071486114 10:86103771-86103793 GGGAGGTGGGCAGTGTCCCAGGG - Intronic
1072565004 10:96610016-96610038 GGGAGGGGGCCACCAACCCAGGG - Intronic
1074248011 10:111713981-111714003 TGGAGGGGGCCAAAATGGCAGGG + Intergenic
1075161987 10:120032412-120032434 GGGAGCTGGGGAAAAACCCAGGG + Intergenic
1077556819 11:3229984-3230006 GGGAGGCAGCACAAATCCCAGGG + Intronic
1079190608 11:18273912-18273934 GTGAGGTGGACAGAATCCTAAGG + Intergenic
1079242218 11:18729079-18729101 GGGAGGTGCCCCAAAAGCCATGG + Intronic
1079665546 11:23100455-23100477 AGGAGGTGGCCCAAACCCCTTGG - Intergenic
1080715021 11:34791876-34791898 GGGAGGAGGCCAAACTCCAAAGG + Intergenic
1080771216 11:35343653-35343675 GGTAGGTCCCCAAATTCCCAGGG - Intronic
1081426253 11:42929356-42929378 GGGAGAGGGTCTAAATCCCAGGG + Intergenic
1089213141 11:116819796-116819818 GGGAGGTGGCTAGACTCGCAGGG + Intergenic
1090451878 11:126813493-126813515 GTCAGGTGGACAAAATCTCAAGG - Intronic
1092857532 12:12688784-12688806 GGGAGGTGGCCAATACTCCCTGG + Intronic
1092912724 12:13162197-13162219 GGGAGGTGAGCAAAATCTCAGGG + Intergenic
1097440793 12:59605394-59605416 GGGAGGTGGCAAGACTCCCATGG + Intronic
1100194400 12:92227705-92227727 GAGAGGTGGCCTAACTCCCCTGG + Intergenic
1104671428 12:130683254-130683276 GTGATGTGGCCACAAGCCCAAGG + Intronic
1106691132 13:32117922-32117944 GGGAGCTGCCCAAAGTCACATGG - Intronic
1106901362 13:34357692-34357714 GGCAGGTGGGCAGAATCCCATGG - Intergenic
1108044621 13:46372004-46372026 GGGAGGTGGCCAAAATCCCAGGG + Exonic
1108994587 13:56711826-56711848 GGGAGGTATACAAAATACCAGGG + Intergenic
1113578971 13:111414571-111414593 GGCAGGTGGTCACACTCCCATGG - Intergenic
1113780480 13:112973940-112973962 GGAAGGCGGCCACCATCCCAAGG - Intronic
1114357256 14:21924673-21924695 GGGAGGTGTACAAAAGCCCTGGG + Intergenic
1114629798 14:24151676-24151698 GGGAGGAGGCAAGAAGCCCAAGG + Intronic
1116160896 14:41265665-41265687 GGGAGGTGCCCAGAATCCTTTGG - Intergenic
1116740967 14:48753896-48753918 GGGAGGTGGCTAAAAATGCAGGG + Intergenic
1118008841 14:61589907-61589929 AGGAAGTGGTCAAAAACCCAGGG + Intronic
1120275164 14:82363963-82363985 GGGAAGTGGCCAAAAATTCAGGG + Intergenic
1121967658 14:98325485-98325507 GGTAGGTGGCCAAAAGACCAAGG + Intergenic
1122474948 14:102001064-102001086 GGTAGGTGGCCAGTATCGCACGG + Exonic
1129316642 15:74749259-74749281 CTGAGGTGGCCAAGGTCCCAGGG - Intronic
1129489217 15:75906688-75906710 GGGAGCTGGCCAGTATCCAAAGG + Intronic
1129532818 15:76282287-76282309 GTGATGTGGCCACAAGCCCAGGG + Intronic
1130290249 15:82592744-82592766 GGAAGGTGGCCAAAGTGCCGAGG + Intronic
1131147692 15:90024773-90024795 AGGAGGTGGCCAAAAACTCCAGG - Intronic
1133507775 16:6429293-6429315 GGGAGCTGGCAAAGATCCCAGGG - Intronic
1135066758 16:19316777-19316799 AGAAGATGGCCAAAATGCCATGG - Intronic
1136187354 16:28596148-28596170 CGGAGCTGTTCAAAATCCCAGGG + Exonic
1136189834 16:28609073-28609095 CGGAGCTGTTCAAAATCCCAGGG + Intronic
1136686437 16:31997330-31997352 GGAAGGAGGCCAAAGCCCCAAGG + Intergenic
1136787048 16:32940859-32940881 GGAAGGAGGCCAAAGCCCCAAGG + Intergenic
1136882726 16:33912930-33912952 GGAAGGAGGCCAAAGCCCCAAGG - Intergenic
1137679109 16:50323673-50323695 GGCACGTGGCCAAAAACTCATGG + Exonic
1203089285 16_KI270728v1_random:1202529-1202551 GGAAGGAGGCCAAAGCCCCAAGG + Intergenic
1142605268 17:1077946-1077968 GGGAGGTGTCCAGAAGCCCGTGG - Intronic
1143287294 17:5799818-5799840 GGAATGTGGCCACAACCCCAGGG + Intronic
1143739529 17:8942243-8942265 GGGAGGTGGCCAAGATAGGAAGG - Intronic
1146006493 17:29163776-29163798 GGGAGCTGGCAACAATCCCCTGG + Intronic
1146526629 17:33572460-33572482 GGGATGTGGCCTAGATTCCAAGG - Intronic
1147147395 17:38492999-38493021 GGAAGGAGGCCAAAGCCCCAAGG + Intronic
1148051327 17:44771466-44771488 TGCAGGTGGCCACAATCCCTGGG - Intronic
1148560741 17:48604489-48604511 CGGAGGGGGAAAAAATCCCAAGG - Exonic
1148618461 17:49016879-49016901 AGGAGCTGGCCGAAAGCCCAGGG - Intronic
1151341845 17:73476825-73476847 GGGAGGGGGCCAGCAGCCCACGG - Intronic
1151632960 17:75323684-75323706 GGGTGGTGGCCAAAACCACGGGG - Intronic
1153394421 18:4602418-4602440 GGGAGGTGGGGAACATCCCCTGG - Intergenic
1153662233 18:7335094-7335116 GGGAGGTGGCCACATTCCTCAGG - Intergenic
1153886525 18:9473021-9473043 GGCGGGTGGTCAAAAACCCAAGG - Intergenic
1155271482 18:24145593-24145615 AGGAGTTGGACAAAAACCCAAGG - Intronic
1156147827 18:34207733-34207755 TGGAGATGGCCTCAATCCCATGG - Intronic
1157281022 18:46346433-46346455 GGGAGGAGGCCCTAAACCCAAGG - Intronic
1160958738 19:1707636-1707658 GGGAGCTGCCCTACATCCCAAGG + Intergenic
1161658915 19:5533934-5533956 GGAAGGTGGCCACCATCACAGGG + Intergenic
1163455676 19:17404488-17404510 GGGAGGAGGCCCAGGTCCCAGGG - Intronic
1164727087 19:30473276-30473298 GGGAGCTGGCCAAAACACCCTGG + Intronic
1165271084 19:34708164-34708186 TGTAGGTAGCCAAAATACCATGG + Intergenic
1166405533 19:42519312-42519334 GAGAGCTGGCTAAAATCTCAGGG - Intronic
1167695051 19:51010245-51010267 GGGAAGAGGCCCAAATCCCCAGG - Intergenic
1167880564 19:52453994-52454016 GTGGGGTTTCCAAAATCCCAGGG - Intronic
926296239 2:11571004-11571026 GGGGTTTGGCCAAAATACCAAGG + Intronic
926725098 2:15991627-15991649 GAGGGGTGCCCAAAAGCCCATGG + Intergenic
928275080 2:29893177-29893199 GGAAAGTGGCTGAAATCCCAGGG - Intronic
928427670 2:31192413-31192435 GGGAGGTGACCATGATCCTAGGG + Intronic
929024539 2:37587105-37587127 GGAAGGTGGCCAAGCTTCCATGG + Intergenic
929768269 2:44869069-44869091 CGTATGTGGCCTAAATCCCAAGG + Intergenic
930398182 2:50848751-50848773 TGGATGTGGCAAAAATGCCAGGG + Intronic
931718064 2:65045083-65045105 GTGAGTTAGCCAAAAACCCAGGG - Intergenic
931838113 2:66121060-66121082 GGGAGTTGGCCAAACTCACCTGG + Intergenic
932171044 2:69556703-69556725 GGGCGGTGTCCTATATCCCATGG + Intronic
934768537 2:96894085-96894107 GGGTGGTGGCCAAGAGCTCAGGG + Intronic
935726197 2:106026158-106026180 GGCAGCTGGCCAATATCCCACGG - Intergenic
935926445 2:108074710-108074732 GGGCGATGGCCAATTTCCCAAGG - Intergenic
936278275 2:111118787-111118809 AGGAGGTGACCTAAAACCCATGG + Intergenic
940799889 2:158122027-158122049 GGGAGGGGGTACAAATCCCACGG + Intronic
942140374 2:172971569-172971591 GGGAGATGGGAAAAATCCCAAGG - Intronic
948236326 2:236393779-236393801 GGCAGGTGGCCAAAACCCTCGGG - Intronic
948765871 2:240218416-240218438 AGGAGGGGGGCAAAATCTCAGGG + Intergenic
1170298161 20:14852217-14852239 GCGAGGTGGCCAAGAAACCAAGG + Intronic
1171066296 20:22018620-22018642 GGGAAGAGGCCCACATCCCATGG + Intergenic
1171183827 20:23110800-23110822 GTGATGTGGCCACAAGCCCAGGG - Intergenic
1171412360 20:24956067-24956089 GGGATGGGGCGACAATCCCAAGG + Intronic
1173304547 20:41835787-41835809 GGGAGGTGGCCAGAGACCAAAGG + Intergenic
1173708882 20:45137132-45137154 GGGAGGTAGCCAAAGTGGCAAGG - Intergenic
1174449153 20:50609203-50609225 GGGAATTGGCCAGAATCCCAGGG - Intronic
1175816613 20:61886382-61886404 GGGAGGTGAGCAAAAACCCCAGG + Intronic
1176742438 21:10616695-10616717 GGGAGGGGGACAAAAACCCGGGG - Intergenic
1176931394 21:14815201-14815223 GGGATGTGGCAAACTTCCCAGGG + Intergenic
1180159973 21:45994642-45994664 TGGAGGTTTCCAGAATCCCAGGG + Intronic
1182447329 22:30397358-30397380 GGGGGGTGGCCAAACTTCCTGGG - Intronic
1183270506 22:36859721-36859743 GGAACGTGGCCAACAGCCCATGG - Intergenic
1183743756 22:39681840-39681862 GGGAGGGGACCAAAATGACATGG - Intronic
1184343934 22:43901521-43901543 GGGAGGTGGCCACCAGCCAAGGG - Intergenic
1184602395 22:45551401-45551423 GGCAGCTGGCCAAGAGCCCAAGG - Intronic
1185181740 22:49367517-49367539 GGCAGGTGGGCCAGATCCCAGGG - Intergenic
1185182843 22:49373014-49373036 GGGAGGTGAGCAGAAGCCCAGGG + Intergenic
953542757 3:43836672-43836694 GGGAGGTGGACAATAATCCAAGG - Intergenic
954630170 3:52043731-52043753 GGGAGGGGGTCAAAACCCAAAGG + Intergenic
955463212 3:59208386-59208408 GGAAGGTGGCCAGAAGCCAAAGG + Intergenic
955829545 3:62986566-62986588 TGGAGGTTACCAAAATCCCTTGG + Intergenic
956152070 3:66253824-66253846 AGGAGGTGACAAACATCCCATGG - Intronic
956928011 3:74010164-74010186 GGGAGGTCCCCAAATTCCCGTGG - Intergenic
960463671 3:117968662-117968684 GGGAGGTGTGCAAACTCCCAAGG + Intergenic
964535102 3:157712512-157712534 GGGAGGAGGTCAAAATATCAAGG + Intergenic
964757534 3:160102169-160102191 GGCACGTGGCCAAAAACTCATGG - Intergenic
966102494 3:176288655-176288677 GGGAGGTGATCAAAATCACCTGG - Intergenic
967609930 3:191492215-191492237 GGGAGGTGGTAAGAATCCAAAGG - Intergenic
967629231 3:191723881-191723903 GGGAGGATGCCTAAATTCCATGG + Intergenic
968804018 4:2761119-2761141 GGCAGGTGCCCAAAGTCACACGG - Intergenic
969506618 4:7591910-7591932 AGGAGGTCCCCAATATCCCATGG - Intronic
969897079 4:10315534-10315556 GGGTGGTGGCCAACATGGCAGGG + Intergenic
970953996 4:21789203-21789225 GGGAGGTGGCATGAAACCCAGGG - Intronic
972863651 4:43203062-43203084 GCGGAGTGGGCAAAATCCCATGG - Intergenic
976104421 4:81601536-81601558 GGAAGGTGGTGAGAATCCCAGGG + Intronic
986865085 5:11976773-11976795 TGGATGTGGCTAATATCCCATGG - Intergenic
987089924 5:14501602-14501624 AGGAGGTGGCCACCACCCCAGGG + Intronic
987147555 5:15006937-15006959 GGGAGATGACCACAATTCCATGG + Intergenic
987944037 5:24581130-24581152 GGGGGGTGCCCAGAATCCCTAGG - Intronic
990216582 5:53539492-53539514 GTGATGTGGCCACAACCCCAGGG - Intergenic
992066666 5:73115977-73115999 GGGAGGAGGAAAATATCCCAGGG + Intergenic
995007151 5:107213360-107213382 GGGTGGGGGTCAACATCCCAGGG + Intergenic
995319407 5:110815482-110815504 GGGAGGTGGCTACAATTGCAAGG + Intergenic
996030366 5:118698052-118698074 GGGAGAGGGCCAAAATTCTATGG - Intergenic
998140538 5:139697343-139697365 GAGACGTGGCCAAAGACCCAAGG - Intergenic
998414930 5:141939356-141939378 GAGAGGTAGCAAAAATCACAGGG + Exonic
1001351759 5:170974681-170974703 TGGAGGTGGCCACACCCCCATGG + Intronic
1002629764 5:180563926-180563948 AGGAGGGGGAAAAAATCCCAGGG - Intronic
1003384703 6:5656464-5656486 GGGGGGTGGCAAGAATCACAAGG - Intronic
1006116856 6:31780189-31780211 GGGAGGGTGCCAGAACCCCATGG + Intronic
1006409279 6:33862982-33863004 GGGAGGGGCCCAGAATCCTAGGG + Intergenic
1013571513 6:111431157-111431179 GGCACGTGGCCAAAAACTCATGG - Intronic
1014538804 6:122649540-122649562 AGGAAGTGGCCCAAATCCCATGG - Intronic
1014899558 6:126946226-126946248 AGAACGTGGCCAAAATCCAAGGG + Intergenic
1017054908 6:150427966-150427988 GAGTGGTGGCCATAAACCCATGG + Intergenic
1017561976 6:155637910-155637932 GAGATGTGGCCACAATCCAAGGG + Intergenic
1022566489 7:31407811-31407833 CAGAGGTGGACAAAATCCAAGGG + Intergenic
1025033491 7:55575659-55575681 GGGAGGTCCCCCAAATGCCAAGG + Intergenic
1025263489 7:57438218-57438240 GGGAGTGGGCCAATGTCCCAGGG + Intergenic
1029046078 7:97630232-97630254 AGGAGGGGGCCTATATCCCAGGG + Intergenic
1029815943 7:103095223-103095245 GGCATGTGACCAAAGTCCCAGGG - Intronic
1031769946 7:125830508-125830530 GTGATGTGGCCAAAGTCACAAGG + Intergenic
1033168677 7:139064486-139064508 TGAAGGTGCCCAAAAGCCCAAGG + Intronic
1033609864 7:142954588-142954610 GGGAGGTGGGGAATATACCATGG + Intronic
1036767042 8:11555884-11555906 GTGACTTGGCCAAAGTCCCACGG - Intronic
1036788448 8:11702930-11702952 AGGAGTTGGCCACGATCCCATGG + Intronic
1038037751 8:23700966-23700988 GAGAAGTGGCAAAAATCCAAAGG + Intergenic
1039848790 8:41344692-41344714 AGGAAGAGGCCAAAATCCTAAGG - Intergenic
1042565148 8:70103273-70103295 AGGAGGTGGCCAAGACCCTAGGG - Intergenic
1045323030 8:101096289-101096311 AGGAGGTGGCCAGAATCTCTGGG + Intergenic
1048016546 8:130502131-130502153 TGGGGGTGGCCAATATCCAATGG - Intergenic
1048474265 8:134729299-134729321 GCGAGGTGGATGAAATCCCAGGG - Intergenic
1049379562 8:142305281-142305303 AGGAGGTGGCATCAATCCCAAGG - Intronic
1051273184 9:15374803-15374825 CAGAGGTGGCCATAATCCCCTGG + Intergenic
1054701565 9:68418316-68418338 GGGAGGTGACAGAAACCCCATGG - Intronic
1056631158 9:88294174-88294196 GGCTGGTGGCCAAAAGACCAAGG - Intergenic
1057623133 9:96654717-96654739 AGGATCTGGCCAAAATCCCCAGG - Exonic
1059450755 9:114370314-114370336 CTGAGGTGACCCAAATCCCAGGG + Intronic
1061532926 9:131228936-131228958 GTGTGGTTGCCAAAACCCCAAGG + Intronic
1062361891 9:136192347-136192369 GGGTGGGGGCCCAAATCCCCGGG - Intergenic
1185452661 X:291000-291022 GGGAGGTGGCCAAGCTCCCGTGG + Intronic
1185484991 X:475334-475356 GTGAGGCGGCCACAAGCCCAGGG - Intergenic
1185517330 X:710002-710024 GAGAGGCGGCCACAAACCCAGGG - Intergenic
1185527980 X:794339-794361 GTGAGGCGGCCACAAGCCCAGGG + Intergenic
1185543933 X:926578-926600 GTGAAGTGGCCACAAGCCCAGGG - Intergenic
1185543996 X:926914-926936 GTGATGTGGCCACAAGCCCAGGG - Intergenic
1185577293 X:1184111-1184133 GTGAGGCGGCCACAAGCCCAGGG - Intergenic
1185586670 X:1246330-1246352 GTGAGGTGGCCACAGTCCCAGGG + Intergenic
1185586732 X:1246667-1246689 GTGAGGCGGCCACAAACCCAGGG + Intergenic
1185665606 X:1763062-1763084 GTGATGTGGCCACAAGCCCAGGG + Intergenic
1185677396 X:1859876-1859898 GTGATGTGGCCACAAGCCCAGGG - Intergenic
1185677452 X:1860219-1860241 GTGATGTGGCCACAGTCCCAGGG - Intergenic
1185691027 X:2155343-2155365 GTGATGTGGCCACAAGCCCAGGG - Intergenic
1185691129 X:2156017-2156039 GTGATGTGGCCACAAGCCCAGGG - Intergenic
1185699011 X:2216321-2216343 GTGATGTGGCCACAAGCCCAAGG + Intergenic
1185792573 X:2938591-2938613 GTGATGTGGCCACAAGCCCAGGG + Intronic
1185813609 X:3132982-3133004 GTGATGTGGCCACAAACCCAGGG - Intergenic
1185822744 X:3220448-3220470 GTGATGTGGCCACAAGCCCAGGG - Intergenic
1185866850 X:3631760-3631782 GTGATGTGGCCACAAGCCCAGGG + Intronic
1185895342 X:3853657-3853679 GTGATGTGGCCACAAGCCCAGGG + Intergenic
1185900459 X:3892081-3892103 GTGATGTGGCCACAAGCCCAGGG + Intergenic
1185905575 X:3930512-3930534 GTGATGTGGCCACAAGCCCAGGG + Intergenic
1186192847 X:7083015-7083037 GTGATGTGGCCACAAGCCCAGGG + Intronic
1187014015 X:15308242-15308264 GAGAGGTGGCCAAATGCCAATGG - Intronic
1187547486 X:20267365-20267387 GGGAGGTGGGCAAAGTACCGGGG + Intergenic
1193211146 X:78808653-78808675 GGTAGGTGGCCAGAAGACCAGGG + Intergenic
1193247676 X:79248870-79248892 TGGTGGTGGCCCAAATGCCATGG + Intergenic
1193290060 X:79762277-79762299 GAGAGGCAGCCAAAATCCCCTGG - Intergenic
1197493957 X:127154163-127154185 GGGACGTGGCCTAAAAGCCATGG - Intergenic
1198379160 X:136068105-136068127 GGGAGATGGCCAAACTGGCATGG + Intergenic
1199938819 X:152604212-152604234 TGGAGGTGGGCAAAATTACATGG - Intergenic
1201252096 Y:12069503-12069525 GTGATGTGGCCACAAGCCCAGGG + Intergenic
1201280570 Y:12338773-12338795 GTGATGTGGCCACAAGCCCAGGG - Intergenic
1201280619 Y:12339104-12339126 GTGATGTGGCCACAAGCCCAGGG - Intergenic
1202049846 Y:20769005-20769027 GGGAGGTGGCCAACAGACAAGGG - Intronic