ID: 1108044668

View in Genome Browser
Species Human (GRCh38)
Location 13:46372286-46372308
Sequence GCGGCTGTTGCTGCACATCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108044662_1108044668 17 Left 1108044662 13:46372246-46372268 CCACTGTTCCCTGCTGCTGGCAC 0: 1
1: 0
2: 5
3: 67
4: 450
Right 1108044668 13:46372286-46372308 GCGGCTGTTGCTGCACATCCTGG 0: 1
1: 0
2: 1
3: 10
4: 131
1108044666_1108044668 -5 Left 1108044666 13:46372268-46372290 CCTGAGATTGCAAGTCCTGCGGC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1108044668 13:46372286-46372308 GCGGCTGTTGCTGCACATCCTGG 0: 1
1: 0
2: 1
3: 10
4: 131
1108044663_1108044668 9 Left 1108044663 13:46372254-46372276 CCCTGCTGCTGGCACCTGAGATT 0: 1
1: 0
2: 1
3: 22
4: 213
Right 1108044668 13:46372286-46372308 GCGGCTGTTGCTGCACATCCTGG 0: 1
1: 0
2: 1
3: 10
4: 131
1108044664_1108044668 8 Left 1108044664 13:46372255-46372277 CCTGCTGCTGGCACCTGAGATTG 0: 1
1: 0
2: 2
3: 19
4: 184
Right 1108044668 13:46372286-46372308 GCGGCTGTTGCTGCACATCCTGG 0: 1
1: 0
2: 1
3: 10
4: 131
1108044661_1108044668 18 Left 1108044661 13:46372245-46372267 CCCACTGTTCCCTGCTGCTGGCA 0: 1
1: 0
2: 2
3: 33
4: 317
Right 1108044668 13:46372286-46372308 GCGGCTGTTGCTGCACATCCTGG 0: 1
1: 0
2: 1
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108044668 Original CRISPR GCGGCTGTTGCTGCACATCC TGG Exonic
902225712 1:14995277-14995299 GCATCTGCTGCTCCACATCCCGG + Intronic
911161461 1:94686322-94686344 TGGGCTGGGGCTGCACATCCAGG + Intergenic
912795794 1:112692809-112692831 GCGGCTGCTGCTGCACCTGGAGG + Exonic
913327739 1:117641720-117641742 GCTGCTGTTGCTCCACTTGCAGG + Intergenic
915191903 1:154157905-154157927 GTAGGTGTTGCTGCACTTCCTGG + Intronic
919810063 1:201403429-201403451 GTTGCTGATGCTCCACATCCTGG - Intergenic
920020560 1:202952640-202952662 GGGGCTATTGGTGCACGTCCCGG - Intronic
920039475 1:203086106-203086128 TAAGCTGTTGCTGCACATCAAGG + Intergenic
922196641 1:223364716-223364738 GCGGCGGTGGCTGCAGACCCGGG + Intergenic
922331616 1:224581908-224581930 GTAGCTGCAGCTGCACATCCTGG + Intronic
922807286 1:228397022-228397044 GGGGCTGCAGCTTCACATCCTGG + Exonic
1062824037 10:555918-555940 GCGGCTGCTGCTGCAGGGCCGGG - Intronic
1064337762 10:14458999-14459021 GTGCCTGTTCCTCCACATCCAGG - Intronic
1065976459 10:30846747-30846769 CCTGCTGTGGCTGCAGATCCAGG + Intronic
1067580470 10:47442456-47442478 GAGGCTGTTGTTGTACCTCCAGG - Intergenic
1069957693 10:72061876-72061898 GAGGCTGTGGCTGCAGAGCCTGG - Exonic
1074923844 10:118046888-118046910 GCGGCTGCGGCGGCACTTCCGGG + Intergenic
1077953800 11:6991309-6991331 CTGGCTGGTGCTGGACATCCTGG - Intergenic
1082218819 11:49607443-49607465 GTGGCTGTTTCTACACATCTGGG - Intergenic
1082271174 11:50170582-50170604 GCACCTGTGGCTGCACCTCCAGG + Intergenic
1083735080 11:64675584-64675606 CCGGCTGCTGCTGCAGAGCCAGG + Intronic
1086403357 11:86479237-86479259 GGGGCCGCTGGTGCACATCCTGG - Intronic
1086630751 11:89016679-89016701 GTGGCTGTTTCTACACATCTGGG + Intronic
1087272864 11:96129411-96129433 GATGCTGATGCTGCTCATCCAGG + Intronic
1091190267 11:133687877-133687899 GGGGCTGCTGCTGCCCAGCCTGG - Intergenic
1096977363 12:55707293-55707315 GCGTCTGAAGCTGCACTTCCCGG - Intronic
1101508490 12:105370870-105370892 GAGGCTGTTGTTGCCCAGCCAGG + Exonic
1102192530 12:110999328-110999350 GGGGCTTTTGCTGCACCGCCTGG + Intergenic
1103759734 12:123240029-123240051 GAGGCTGTTGCTGCTGGTCCAGG - Intronic
1105585459 13:21738851-21738873 GCAGCTGCAGCTGCACATCAGGG + Intergenic
1108044668 13:46372286-46372308 GCGGCTGTTGCTGCACATCCTGG + Exonic
1113600333 13:111563787-111563809 GGGGCTGTGGGTGCACATCAGGG - Intergenic
1115075974 14:29390837-29390859 GCGGCTCTTGCTGCTCATTGGGG - Intergenic
1118342364 14:64905394-64905416 GAGGCTGTTGCTAAACTTCCAGG + Intergenic
1122843366 14:104477339-104477361 GCGGCTCTTGCTCCACAGGCGGG - Intronic
1128340000 15:66815407-66815429 GTTCCTGTTGCTCCACATCCTGG - Intergenic
1129763942 15:78149371-78149393 GCGGCTGTTGCTGCGGAGCCAGG + Exonic
1131767188 15:95691015-95691037 GAAGCTGATGCTGCACATCTAGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1136247829 16:28985453-28985475 GCTCCTGCTGCTGCCCATCCTGG + Exonic
1137726282 16:50658892-50658914 GCTCCTGTTGCTCCACATGCTGG - Intergenic
1137966384 16:52937808-52937830 GTTCCTGTTGCTTCACATCCTGG - Intergenic
1138939439 16:61772751-61772773 GAGGCTGATGCTGCAGGTCCAGG - Intronic
1142128210 16:88420564-88420586 GCGCCTGTCGTTCCACATCCTGG - Intergenic
1142721443 17:1778684-1778706 TGGGCTGTCGCTACACATCCTGG + Intergenic
1144783061 17:17817421-17817443 GCGGCCGTCTCTGCACAGCCGGG - Exonic
1145165948 17:20613639-20613661 TCGTCTGTTGCTGCAGCTCCAGG + Intergenic
1146205291 17:30899432-30899454 GCACCTGATGCTGCCCATCCTGG + Exonic
1148178042 17:45584752-45584774 CCGGCTACTGCTGCCCATCCTGG + Intergenic
1148665100 17:49368600-49368622 GCGGGTATTGCAGCAAATCCTGG + Intergenic
1149169363 17:53791758-53791780 GCAGCTGTAGCTGCACCTGCAGG - Intergenic
1149651600 17:58279519-58279541 GCACCTGTTGTTGCACATCCCGG + Exonic
1150156278 17:62856048-62856070 GCCGTTGTTGCTCCACATCACGG - Intergenic
1152266402 17:79297374-79297396 TGGGGTGCTGCTGCACATCCCGG + Intronic
1152365249 17:79851959-79851981 GCAGCTGCTGCTGCACATCTCGG + Intergenic
1152408797 17:80111844-80111866 GCGGCTGCAGGTGCACCTCCAGG + Intergenic
1152940021 17:83164100-83164122 GCTCCTGTTGCTACACATCCTGG + Intergenic
1154167276 18:12025502-12025524 GTTCCTGTTGCTCCACATCCTGG + Intronic
1154176908 18:12091959-12091981 GCGGCTGGGGCTGCGCAGCCTGG - Intergenic
1160416233 18:78713318-78713340 GTGGCTGTTTCTCCTCATCCCGG + Intergenic
1160710519 19:549091-549113 GCGGCTGTTGTTACACATGCGGG - Exonic
1160767024 19:813235-813257 GCCGCCGCTGGTGCACATCCCGG - Exonic
1160807930 19:1000773-1000795 GCTGCTGCAGCTGCACTTCCTGG + Exonic
1161218405 19:3106205-3106227 GCGGCTGGGGCTCAACATCCAGG - Intronic
1161787137 19:6333714-6333736 GCTGCTGTCACTGCACAGCCAGG - Intergenic
1165227726 19:34366160-34366182 GCTGCTGTTGCAGATCATCCTGG + Intronic
1166210536 19:41304066-41304088 GCGGCTGTTGCTGGGGAGCCCGG - Exonic
1167529856 19:50008498-50008520 GTGGCTGTGGCTTCAGATCCAGG + Intronic
926243557 2:11105592-11105614 GTGGCTGCTCCTGCACAGCCAGG + Intergenic
926980398 2:18561302-18561324 GCTGCTGCTGCTGCAGATCTGGG + Intronic
927151111 2:20196722-20196744 GCGGCTGTGTCTGCCCCTCCAGG - Intergenic
927523078 2:23712965-23712987 CTGGCTGGTGCTGCACATCAGGG - Intergenic
927643756 2:24862057-24862079 GAGGCTGTGGATGCAAATCCAGG + Intronic
928689351 2:33783049-33783071 GGGGCTGTGGCTCCACCTCCTGG - Intergenic
930272045 2:49268692-49268714 ATGGCTGTTGCTGCACAACTAGG - Intergenic
936521121 2:113212709-113212731 GCTGCTGTTGCTGCAGAGTCGGG - Intergenic
937095372 2:119232041-119232063 CAGGCTGTTTCTGCAAATCCAGG - Intronic
937543612 2:122988961-122988983 GCAGCTGCAGCTGCACAGCCCGG - Intergenic
942139782 2:172966466-172966488 GCTGCTGCTGCTGCTCCTCCAGG + Intronic
943706596 2:191041788-191041810 GGGGCTCTTACAGCACATCCTGG - Intronic
944772062 2:202924736-202924758 GCTGCTGCTGTTGCCCATCCAGG - Intronic
1171405675 20:24910866-24910888 GAGGCTGGTGCTGCCCACCCAGG - Intergenic
1172038856 20:32029759-32029781 CCGGCTGGGGCTGCCCATCCAGG + Exonic
1174734996 20:52957376-52957398 GCTGCTGCTGCTGCTGATCCAGG - Intergenic
1176179342 20:63742114-63742136 GCCCCTGTTGCTGCAGAGCCCGG + Exonic
1176963268 21:15183921-15183943 GCAGCTGTGGCTGCAAATCAAGG - Intergenic
1179472608 21:41621665-41621687 GCGGGTGTTGGTGTACATCTGGG - Intergenic
1179976920 21:44873532-44873554 GCTGCTCCTGCTGCTCATCCCGG - Exonic
1180135784 21:45861012-45861034 GCGGCTCCTCCTGCCCATCCTGG + Intronic
1180628334 22:17209512-17209534 GCGGCTGGTGCTGAACACCAAGG - Exonic
1180972784 22:19824319-19824341 GCGGCCTTTGCTCCACAGCCTGG - Intronic
1182182598 22:28365599-28365621 GAGGCTGTTTCTGCAAATGCTGG + Intronic
1182550802 22:31099918-31099940 GCTAATGTTGCTGCACATCTGGG + Intronic
1185319701 22:50194887-50194909 GTGGCTGTTGCAGACCATCCGGG + Exonic
951849804 3:27126557-27126579 GCTGCTGCTGCTGCTGATCCAGG - Intronic
952628134 3:35431599-35431621 GTTCCTGTTGCTCCACATCCTGG + Intergenic
954385857 3:50243426-50243448 GGGGCTGTTGCTGCATTTCCAGG - Intronic
956744484 3:72300627-72300649 GAGGCTGTTGCCAAACATCCAGG - Intergenic
957898559 3:86455766-86455788 GATCCTGTTTCTGCACATCCTGG - Intergenic
961827455 3:129606522-129606544 GCTGCTGTTGCTGCTGCTCCTGG - Exonic
966515951 3:180821073-180821095 GAAGCTGTAGCTGCACTTCCCGG - Intronic
967890595 3:194361666-194361688 GCCGCCGCTGCTGCACCTCCCGG - Intronic
967929872 3:194683197-194683219 CCGGCTGCTGCTGAACAGCCCGG + Intergenic
968548043 4:1208464-1208486 GCGGCTGCTGATGAACACCCGGG - Intronic
969522405 4:7686344-7686366 GTGGCTGGTGCTGCATCTCCCGG + Intronic
980724439 4:136740219-136740241 GCAGCTGTTTCGGCATATCCTGG + Intergenic
981075506 4:140587395-140587417 GCGTGTGTTGCTGCACATCCTGG + Intergenic
986668599 5:10124512-10124534 GCAGCTGTGACTGCACAGCCTGG + Intergenic
997969491 5:138389110-138389132 GCTGCTGTTGCTTCACAGGCAGG - Intronic
1001349758 5:170948940-170948962 CAGGCTGTTCCTGAACATCCTGG - Intronic
1002720585 5:181258959-181258981 GCAGCGGCTGCTGCATATCCAGG + Intronic
1003180079 6:3783651-3783673 GAGGCTGGTGCTGCTGATCCAGG + Intergenic
1004670168 6:17788495-17788517 GCGGCTGTTTGTGCGCTTCCTGG - Intronic
1005954618 6:30655243-30655265 CCAGCTGTTCCCGCACATCCCGG + Exonic
1006454382 6:34123563-34123585 GTGGCAGTTGGTGCAGATCCTGG - Intronic
1014612830 6:123565714-123565736 GCGGCTGTTGCCACACAACAAGG - Intronic
1018471582 6:164101884-164101906 CCAGCACTTGCTGCACATCCTGG + Intergenic
1019733722 7:2640519-2640541 GTGGCTGCTGCTGGGCATCCTGG - Intronic
1022095617 7:27139422-27139444 GAGGCTGGGGCTGCACCTCCAGG - Intronic
1023885338 7:44349891-44349913 GGGGCTGTTGCAGCACAGCATGG - Intergenic
1024589314 7:50867547-50867569 GCGCCTGTTGCTGCCCTTCCCGG + Intergenic
1024598674 7:50961330-50961352 GATGCTGATGCTGCTCATCCAGG + Intergenic
1035477847 7:159156277-159156299 GCGGCTGATGGTGCCCAGCCTGG + Intergenic
1036660753 8:10706960-10706982 GCGTCTTCTCCTGCACATCCTGG + Intronic
1037952765 8:23029481-23029503 GAGGCTGTGGCTGCCCCTCCTGG - Intronic
1038458418 8:27694380-27694402 GCGGGTGTTCCTGCATATGCTGG - Intergenic
1042046524 8:64658715-64658737 GCTCCTCTGGCTGCACATCCAGG + Intronic
1046628309 8:116598595-116598617 GCAGCTGGTGCTGCTCTTCCAGG - Intergenic
1046771397 8:118119980-118120002 AAGGCTGATGCTGCAGATCCAGG + Intergenic
1049711126 8:144063838-144063860 GCGGCTGGTGCAGCTCATCCAGG - Intergenic
1049789867 8:144467603-144467625 GCGGCTGGAGCAGCTCATCCTGG + Exonic
1055604005 9:77949202-77949224 GTGGCTGTTGCTCTACAGCCTGG - Intronic
1056693723 9:88828927-88828949 GCGTCTGTTTGTGCACATTCTGG + Intergenic
1057054421 9:91949915-91949937 GCGGCCGCTGCTGTGCATCCCGG - Exonic
1058268040 9:102932180-102932202 GCTCCTGTTGCTTCAGATCCTGG - Intergenic
1059567399 9:115396728-115396750 GCGGTTGTTGTTGCACTTGCTGG - Intronic
1186200157 X:7148315-7148337 GCAGCTGTAGCTGCAGACCCGGG + Intergenic
1186513064 X:10145511-10145533 CCGGCAGTTGCTCCACATCCTGG + Intergenic
1187861249 X:23685273-23685295 GAGGGTTTTGCTGCACCTCCAGG + Intronic
1189344661 X:40231998-40232020 GCGGTTGATGCTGCCCATCCCGG - Intergenic
1190192679 X:48290830-48290852 TTGGCTGTTGCTGTACAACCAGG + Intergenic
1199977752 X:152904345-152904367 GCGGCTGTAGCTGCTGTTCCAGG - Intergenic
1200034609 X:153319411-153319433 GAGGCTGCTGCGGCTCATCCGGG - Intergenic