ID: 1108048451

View in Genome Browser
Species Human (GRCh38)
Location 13:46405723-46405745
Sequence AGGTGGGCTAATGCAAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108048451_1108048455 3 Left 1108048451 13:46405723-46405745 CCTAAATTTGCATTAGCCCACCT 0: 1
1: 0
2: 0
3: 22
4: 124
Right 1108048455 13:46405749-46405771 AATTTGCATATAATTGAAAGTGG 0: 6
1: 93
2: 205
3: 247
4: 708

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108048451 Original CRISPR AGGTGGGCTAATGCAAATTT AGG (reversed) Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
902966878 1:20011488-20011510 AGGTGGCCAACTGCAACTTTTGG - Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906234412 1:44195870-44195892 GGGTGGACTAATGCCAATTGAGG - Intergenic
906499874 1:46333820-46333842 AAGCAGGCTAATGCAAATTGAGG - Intergenic
909773187 1:79451762-79451784 GTGTGGGATAATGCAAAGTTAGG - Intergenic
910329048 1:86048101-86048123 AGGGAGGCTACTGAAAATTTAGG - Intronic
916068820 1:161158176-161158198 AGATGAGCTAGTCCAAATTTGGG - Exonic
923202460 1:231725492-231725514 GGGTGAGCTAGTGCAAATTGAGG - Intronic
924123450 1:240825980-240826002 AGGTGGCTTAATGCACTTTTTGG + Intronic
924628091 1:245712229-245712251 ACGTGCGCTATTACAAATTTTGG + Intergenic
1063000856 10:1920811-1920833 AGGTGGAGAAAGGCAAATTTTGG - Intergenic
1063829984 10:9941562-9941584 AGATTGGCTCATGCAATTTTTGG + Intergenic
1065563151 10:26983644-26983666 AAATGGGGTAATGCAAATTTGGG - Intergenic
1078373105 11:10767955-10767977 GGGTGGGCTGATGTAAAGTTTGG - Exonic
1078940566 11:16000425-16000447 AGGTAGGCAAATGCAAAATATGG + Intronic
1079750478 11:24190760-24190782 AGGTGGGCTCCTCCAGATTTGGG + Intergenic
1080020516 11:27554960-27554982 ACGTTGGCTAATACAGATTTTGG - Intergenic
1080920307 11:36702147-36702169 AAGTAAACTAATGCAAATTTGGG + Intergenic
1083506917 11:63166662-63166684 AGGGTGGCAAATGGAAATTTTGG - Intronic
1083574538 11:63780385-63780407 AAGTTGGCTGATGCAAATGTGGG + Intergenic
1085185764 11:74574884-74574906 AGGTGACTTAATACAAATTTTGG + Intronic
1085684065 11:78605773-78605795 AGGTGGGATAAGGCAGAGTTTGG + Intergenic
1086921547 11:92593480-92593502 AGGTGGTCTAATCCCATTTTTGG + Intronic
1087959866 11:104334566-104334588 AGGAGGGATAATGCAAATAAAGG + Intergenic
1088495263 11:110425802-110425824 AAATGGAATAATGCAAATTTGGG + Intergenic
1089836053 11:121371602-121371624 AAATGGGATAATGAAAATTTGGG - Intergenic
1090012268 11:123055732-123055754 AGGTGGGAGAATGCAAAGGTGGG + Intergenic
1093276479 12:17134659-17134681 TGATGGACTAATGCAAATTGAGG - Intergenic
1093654992 12:21684291-21684313 AGGTGGTCAACTGCAGATTTAGG + Intronic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096795273 12:54073210-54073232 AGGTGGCATAATACAAATTTGGG - Intergenic
1100158800 12:91833513-91833535 AGGTGGGTTAATGAAAAGATTGG + Intergenic
1102548129 12:113671352-113671374 AGGTGGACTAATGCAGGTCTGGG - Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1108048451 13:46405723-46405745 AGGTGGGCTAATGCAAATTTAGG - Intronic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112621735 13:101060132-101060154 AGGTAGGCTGATGCAAAGGTGGG + Intronic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1122015660 14:98793609-98793631 AGGTAGGCTGAAACAAATTTTGG + Intergenic
1126418481 15:48444572-48444594 AGGTGGGCAAATGCATCTGTAGG + Exonic
1129929095 15:79394152-79394174 GGGTGGACTAGTGCACATTTAGG + Intronic
1131340291 15:91592994-91593016 AGTTGGGCTAATTCCAGTTTGGG + Intergenic
1132436825 15:101812997-101813019 AGGAAGGCTAAAGCAAATTGAGG + Intronic
1133088444 16:3384259-3384281 AGGTTGGCAAATGCAAAATCAGG + Intronic
1137577825 16:49615257-49615279 CGGCAGGCAAATGCAAATTTCGG + Intronic
1138929492 16:61634727-61634749 AGCTAAGCTAAAGCAAATTTGGG + Intergenic
1140732345 16:77868097-77868119 CTGTAGGCTAATGTAAATTTAGG - Intronic
1141480593 16:84304156-84304178 AGGTGGGGAAATGCCCATTTTGG - Intronic
1141943108 16:87291467-87291489 AGGGGTGCTAATTAAAATTTGGG - Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1144303056 17:13941310-13941332 AGGTGAGTCAATGCAAATTGAGG + Intergenic
1144712997 17:17414672-17414694 TGGTGGGGAAATGAAAATTTTGG - Intergenic
1145778482 17:27545872-27545894 AGGTGGGCTAATCTCAATGTTGG + Intronic
1158001209 18:52621383-52621405 AGGTAGGCTATGGCAAAGTTTGG + Intronic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159337062 18:67081956-67081978 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159337072 18:67082029-67082051 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1162840002 19:13349396-13349418 AGCTGGGCCAAGGCAAATTGGGG - Intronic
926961706 2:18364731-18364753 TGGTGGGACAATGCAAAGTTTGG - Intergenic
930605767 2:53491599-53491621 AGGTGGGGAAATTCATATTTGGG - Intergenic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
931102024 2:59012688-59012710 AGGTGGGCTAAAACCAAGTTGGG + Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
935120316 2:100178395-100178417 GGGTGGGCCAATGCAAATCAAGG - Intergenic
935676528 2:105599095-105599117 AGGTAGGCCACTGCACATTTAGG - Intergenic
937070243 2:119057607-119057629 AGGTGGGCAAATGCAGAAATGGG + Intergenic
937519764 2:122697972-122697994 AGGGGGACTAATCCAACTTTGGG + Intergenic
937943991 2:127314422-127314444 AGATGGCCTGATTCAAATTTGGG - Intronic
939491880 2:142886332-142886354 AGGTCAGCTAATACAATTTTAGG + Intronic
1169262810 20:4149938-4149960 TGGTGGCCGAATGCAAATGTGGG - Intronic
1172517254 20:35543330-35543352 AGGTGGTTTAATGAGAATTTAGG + Intronic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1173691093 20:44961696-44961718 AGGGTGACTAATGCAAAGTTAGG - Intergenic
1176421633 21:6520717-6520739 AGGTCAGCTTTTGCAAATTTTGG - Intergenic
1178026796 21:28477635-28477657 GGGTGAGGTAATGCAAATTGAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1179697123 21:43129033-43129055 AGGTCAGCTTTTGCAAATTTTGG - Intergenic
1179813507 21:43887388-43887410 AGCTGGGGAAATGCAAATGTAGG + Intronic
1182624138 22:31633773-31633795 AGGTGGGGTAGTGCTAATCTCGG - Intronic
1182763861 22:32744583-32744605 AGACGGTCAAATGCAAATTTGGG + Intronic
1184013918 22:41771045-41771067 AGGTGGGCTGAAGCAGATGTGGG - Intronic
1185242915 22:49755981-49756003 GGATGGGCCAATGCAAATTGAGG - Intergenic
950706516 3:14785812-14785834 AGGTGGGCTCGTGTATATTTTGG - Intergenic
951703124 3:25516147-25516169 AGGTGGGTTGATGCAATTTGGGG - Intronic
951719364 3:25681396-25681418 AGCTGGGCCAAAGCAAAATTTGG - Intergenic
958666572 3:97147099-97147121 AGGTGGGCAAAGGAAAATTTAGG - Intronic
960302751 3:116023855-116023877 TGGTGGGATCAGGCAAATTTTGG + Intronic
961105214 3:124234984-124235006 AGCTGGGCTGATGCCAGTTTTGG + Intronic
961741309 3:129034727-129034749 AGGTGGGCTGATGGAAGTCTAGG - Intronic
962518616 3:136177211-136177233 AAATGGGCTAATGCTGATTTGGG - Intronic
962562168 3:136617807-136617829 GGGTGGGCAAATAAAAATTTTGG + Intronic
964383172 3:156119098-156119120 ATGTGGGCTCTTGCACATTTGGG - Intronic
964594080 3:158402017-158402039 AGGTGGGGTAGGGGAAATTTAGG + Intronic
964818769 3:160746701-160746723 AGGTGAGCTAATTCAAAATTAGG + Intergenic
970382916 4:15525905-15525927 ATGTGGGGTAATGCAGATTTGGG + Intronic
970708175 4:18830794-18830816 AGGTGGGTTCAAGCAAATCTGGG - Intergenic
973820187 4:54656683-54656705 AGCTGGGCAACTGTAAATTTTGG + Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
977415474 4:96727395-96727417 AAATTGGCTTATGCAAATTTTGG - Intergenic
978340418 4:107716598-107716620 AGTTGGGCTGAGGGAAATTTGGG - Intronic
978890586 4:113821857-113821879 AGGTGTACTTATGCAAAATTTGG - Intergenic
979277660 4:118831482-118831504 AGGTGGGCAACTGGAAATATGGG + Intronic
981533129 4:145772346-145772368 AGTTGGACTATTGCAAAGTTAGG - Intronic
983283791 4:165714109-165714131 AAGTGGGATAATGTAAATTTTGG + Intergenic
988927161 5:36001270-36001292 AAATGGGATAATGCAAATTTGGG + Intergenic
988936640 5:36090059-36090081 GGGTGGCCCAATGCAAATTAAGG + Intergenic
995033889 5:107511911-107511933 ATGTAAGCTAATGAAAATTTGGG - Intronic
997023511 5:130030154-130030176 AGGTGAGATAATTCAAATTGTGG - Intronic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
998158082 5:139797256-139797278 AGTGGGGCTACTGCAAAGTTTGG + Intronic
998323082 5:141250943-141250965 AGGTGAGTTAATGCAAATTGAGG - Intergenic
999734068 5:154499402-154499424 AGGTGGCATTATGCAGATTTAGG + Intergenic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1009690630 6:67028004-67028026 AGGTAGGCTAATGCATTTGTTGG - Intergenic
1010250038 6:73697663-73697685 AGGTAAGATACTGCAAATTTGGG - Intronic
1010420338 6:75666582-75666604 AGGAGGTCCAAAGCAAATTTAGG + Intronic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010940179 6:81907488-81907510 AGGTGAGAAAATGCAATTTTTGG + Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1013848209 6:114480494-114480516 ATGTGGGCTAAAGCTAATGTGGG - Intergenic
1016030865 6:139336513-139336535 ACTTGGGCTAATTGAAATTTGGG - Intergenic
1023507302 7:40913396-40913418 GGGTGGACTAATGGAAATTTGGG - Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1027850718 7:83448147-83448169 TGGTGGGCTAATTAAAATATTGG - Intronic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1036474920 8:9084495-9084517 AGGCTGGAAAATGCAAATTTGGG - Intronic
1036662824 8:10718896-10718918 AGGAGGGCTATTGCCTATTTTGG - Intergenic
1042795887 8:72662762-72662784 AGGAGGGCTAATGGAAGGTTTGG + Intronic
1046860086 8:119081107-119081129 AGGTTGCCTAAGGCAAATTAGGG + Intronic
1051192259 9:14525909-14525931 AAGGGGGCTAATACAAATTGTGG - Intergenic
1053149503 9:35733670-35733692 TGTTGGGCTTATACAAATTTTGG + Intronic
1054783476 9:69188007-69188029 AGCTCCGCTAATGCACATTTTGG - Intronic
1058653183 9:107195990-107196012 AGGTGGTCTAAAGAAAATTATGG - Intergenic
1058771700 9:108240227-108240249 AAGGGGGATAATGGAAATTTGGG + Intergenic
1058995734 9:110297151-110297173 AGGTGGGCTAACTCTGATTTTGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1195018077 X:100798098-100798120 AAATGGAATAATGCAAATTTGGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1196170995 X:112588215-112588237 TGGTGAGCTAGTGCAATTTTGGG - Intergenic
1199160927 X:144610818-144610840 ACATGGGCTAATGCAATTGTTGG - Intergenic