ID: 1108051603

View in Genome Browser
Species Human (GRCh38)
Location 13:46447170-46447192
Sequence ACCTCCTTTAGTCCCCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108051603_1108051609 22 Left 1108051603 13:46447170-46447192 CCATCAAGGGGACTAAAGGAGGT No data
Right 1108051609 13:46447215-46447237 TATTAAAACCAGGAAAACAGTGG No data
1108051603_1108051605 -1 Left 1108051603 13:46447170-46447192 CCATCAAGGGGACTAAAGGAGGT No data
Right 1108051605 13:46447192-46447214 TTAAAACTGGAAGCACACCCTGG No data
1108051603_1108051606 12 Left 1108051603 13:46447170-46447192 CCATCAAGGGGACTAAAGGAGGT No data
Right 1108051606 13:46447205-46447227 CACACCCTGGTATTAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108051603 Original CRISPR ACCTCCTTTAGTCCCCTTGA TGG (reversed) Intergenic
No off target data available for this crispr