ID: 1108055952 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:46485319-46485341 |
Sequence | CTGAATCAGCTCAGCTAGCT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1108055945_1108055952 | 21 | Left | 1108055945 | 13:46485275-46485297 | CCCAAGGAGTATACTGGGGCTGT | No data | ||
Right | 1108055952 | 13:46485319-46485341 | CTGAATCAGCTCAGCTAGCTAGG | No data | ||||
1108055946_1108055952 | 20 | Left | 1108055946 | 13:46485276-46485298 | CCAAGGAGTATACTGGGGCTGTG | No data | ||
Right | 1108055952 | 13:46485319-46485341 | CTGAATCAGCTCAGCTAGCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1108055952 | Original CRISPR | CTGAATCAGCTCAGCTAGCT AGG | Intergenic | ||
No off target data available for this crispr |