ID: 1108055952

View in Genome Browser
Species Human (GRCh38)
Location 13:46485319-46485341
Sequence CTGAATCAGCTCAGCTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108055945_1108055952 21 Left 1108055945 13:46485275-46485297 CCCAAGGAGTATACTGGGGCTGT No data
Right 1108055952 13:46485319-46485341 CTGAATCAGCTCAGCTAGCTAGG No data
1108055946_1108055952 20 Left 1108055946 13:46485276-46485298 CCAAGGAGTATACTGGGGCTGTG No data
Right 1108055952 13:46485319-46485341 CTGAATCAGCTCAGCTAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108055952 Original CRISPR CTGAATCAGCTCAGCTAGCT AGG Intergenic
No off target data available for this crispr