ID: 1108056438

View in Genome Browser
Species Human (GRCh38)
Location 13:46489931-46489953
Sequence AGGGCATTTGGGCAGAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108056438_1108056443 3 Left 1108056438 13:46489931-46489953 CCAAGTTTCTGCCCAAATGCCCT No data
Right 1108056443 13:46489957-46489979 TCACAATCATCAATGCTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108056438 Original CRISPR AGGGCATTTGGGCAGAAACT TGG (reversed) Intergenic
No off target data available for this crispr