ID: 1108056743

View in Genome Browser
Species Human (GRCh38)
Location 13:46492874-46492896
Sequence TTTCTTTAGAGCAACTCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108056743 Original CRISPR TTTCTTTAGAGCAACTCCGC AGG Intergenic
905507517 1:38491736-38491758 TTTCTTAAGAGCAATGCCCCAGG - Intergenic
908900109 1:68946881-68946903 TCTATTTAAAGCAACTCCACAGG + Intergenic
909803149 1:79839995-79840017 TTTCCTCACAGCAACTCAGCAGG - Intergenic
910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG + Intronic
910621452 1:89259914-89259936 TTTCTGTAGAGCAGCCCAGCAGG + Intronic
913956719 1:143305837-143305859 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
913980726 1:143509828-143509850 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
914075087 1:144336258-144336280 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
914104091 1:144630238-144630260 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
920091662 1:203457556-203457578 TTCCTTTAGAGGAAATCAGCTGG + Intergenic
921831750 1:219734921-219734943 TTTCTTTAGGCCAACTCTCCAGG - Intronic
923275866 1:232395798-232395820 TTGCTTTAGAGCAACTAATCAGG - Intergenic
1065291834 10:24238231-24238253 GTTCTTCAGAGGAACTCAGCAGG - Intronic
1066781467 10:38951413-38951435 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
1066955410 10:42165545-42165567 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
1069202527 10:65639159-65639181 TTTCTTTAGAAAAACTACGTGGG - Intergenic
1074443342 10:113497727-113497749 TTTCTCTAAACCAACTCAGCAGG - Intergenic
1074540738 10:114363357-114363379 ATTCTTGAGAGCTAGTCCGCTGG + Intronic
1076628398 10:131836255-131836277 TTTCTTTAGAGCAGGTCTTCTGG - Intergenic
1081335177 11:41856594-41856616 TTTCTTTATAGCAACTCAAATGG + Intergenic
1085158330 11:74317342-74317364 TTCTTTTAGAGCAAGTCTGCTGG + Intergenic
1085881972 11:80478122-80478144 TTTCTTCAGAGCAGCTCAGATGG - Intergenic
1089665410 11:120014769-120014791 TTTCTTCAGAGGACCTCCACAGG + Intergenic
1090095789 11:123741108-123741130 TTGCTTAAGATCATCTCCGCGGG - Intronic
1090194966 11:124807101-124807123 TTTCTTTAGAAAAACTCCAAAGG - Intergenic
1093547686 12:20368285-20368307 TTTCTTTAAGGCAACTCCCTAGG - Intergenic
1096535703 12:52271429-52271451 TTTCTTTTGAGCAAATACCCAGG - Intronic
1097339967 12:58426458-58426480 TTTCTTTAGAGCCAATGGGCAGG - Intergenic
1099362948 12:81729339-81729361 TATTTTTAGAGCAAGTCCTCTGG + Intronic
1101218652 12:102612416-102612438 TTATTTTAGAGCAGGTCCGCTGG - Intergenic
1108056743 13:46492874-46492896 TTTCTTTAGAGCAACTCCGCAGG + Intergenic
1112003032 13:95229350-95229372 TTTCTTTAGAGTTACTCTGAAGG - Intronic
1114257464 14:21015667-21015689 TTGCTTTACAGAAACTCCACAGG - Intergenic
1122485535 14:102077118-102077140 TTTCTTTAGACCATCTGAGCAGG + Intergenic
1202939127 14_KI270725v1_random:127517-127539 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
1128015354 15:64340341-64340363 TTTCTTTAGCACATCTCTGCTGG + Intronic
1132117722 15:99149751-99149773 CATCTTCACAGCAACTCCGCAGG - Intronic
1134754690 16:16656298-16656320 TTTCTTTAAATCAACTTTGCTGG - Intergenic
1134991370 16:18702744-18702766 TTTCTTTAAATCAACTTTGCTGG + Intergenic
1136700028 16:32126659-32126681 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
1136767619 16:32800802-32800824 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
1136800531 16:33069895-33069917 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
1136868663 16:33779826-33779848 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
1136902904 16:34060192-34060214 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
1137085751 16:36121125-36121147 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
1203070012 16_KI270728v1_random:1062828-1062850 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
1203103514 16_KI270728v1_random:1336242-1336264 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
1143048538 17:4102806-4102828 TTTCTTTAAATCATCTCTGCAGG + Intronic
1145324721 17:21795226-21795248 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
1145710714 17:26971848-26971870 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
1146423161 17:32708636-32708658 TTTTTTTGGATCAACTCCACAGG - Intronic
1148416135 17:47508218-47508240 TTTTTTTAAATCAACTGCGCCGG + Intergenic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1152857690 17:82675518-82675540 TTTCATTATAGCAACCCCACTGG - Intronic
1203190085 17_KI270729v1_random:174220-174242 TTTCTTTAGTGGAATTCAGCTGG + Intergenic
1153081131 18:1226464-1226486 TTACTACAGAGCAACTCCTCAGG - Intergenic
1153204824 18:2687299-2687321 TTTCTTTAGAACAAGTCTTCTGG + Intronic
1160002359 18:75037770-75037792 TTTCTGTACAGAAACTCGGCAGG + Intronic
1202668329 1_KI270709v1_random:20627-20649 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
927035680 2:19173577-19173599 CTTCTGTACAGCAACTCAGCTGG + Intergenic
928443809 2:31315449-31315471 TTTCCTTAGACAAACACCGCTGG + Intergenic
931460281 2:62444131-62444153 TTCCTTTAGAGCAACCCCTTTGG - Intergenic
933480635 2:82852893-82852915 TTTCTTTAGAAAAACTCCAAAGG + Intergenic
934252987 2:90379261-90379283 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
934256455 2:91423685-91423707 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
937355925 2:121197991-121198013 TTTATTTTGAGGAACTCCTCTGG - Intergenic
938121028 2:128633761-128633783 TTTCTTTTGAGTAAATCCACAGG + Intergenic
938517444 2:132028558-132028580 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
940818709 2:158327216-158327238 TTTCTATAGAGCAGATCAGCAGG - Intronic
945523537 2:210859926-210859948 TTTCTTTAGAAGAACTTCGCAGG - Intergenic
1170377146 20:15712540-15712562 TTTTTTAAGAGCAACTTCCCTGG - Intronic
1175678329 20:60966159-60966181 TATCATTACAGCAACACCGCTGG + Intergenic
1176584068 21:8559683-8559705 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
1178360574 21:31946038-31946060 TTTGGTTTGAGCAACTGCGCAGG + Exonic
1180266878 22:10536596-10536618 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
1182171799 22:28237782-28237804 GTTCTTTAGTGCAAATCTGCTGG + Intronic
1203288487 22_KI270735v1_random:8834-8856 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
1203326322 22_KI270738v1_random:24737-24759 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
949951184 3:9229950-9229972 TTTATTTACAGCAACTCCCAAGG + Intronic
952082244 3:29773540-29773562 TTTCTTTAGGGCATCTCAGCGGG - Intronic
956918650 3:73902378-73902400 TATCTTTAGACTAACGCCGCAGG - Intergenic
959202618 3:103268440-103268462 TTTCTTTAAATCAAATCTGCAGG - Intergenic
962844491 3:139262766-139262788 TTTCCTTAGGGAAACTACGCGGG + Intronic
967935980 3:194727946-194727968 ATTCTTTAGAGGAACCCCCCAGG - Intergenic
970598846 4:17624865-17624887 TTTCTTAACAGCAACTCAACAGG - Exonic
971972858 4:33642567-33642589 TTTCTTTAGTGAAACCCAGCTGG + Intergenic
982041106 4:151397831-151397853 TTTCTTTATAGCAACACAACTGG - Intergenic
982566976 4:156997809-156997831 TATCTTTATAGCAACTCTTCTGG + Intergenic
983772670 4:171570715-171570737 TTTCTGTAGAGCTTCTCCTCAGG - Intergenic
991467759 5:66932051-66932073 TTTATTTAGAGCAATTCAGAAGG - Intronic
998658607 5:144209699-144209721 CTTCTTTAGAGCATCTCCCATGG - Intronic
1002072568 5:176688980-176689002 TTTCTGTAGAGTAAATCCCCAGG - Intergenic
1002517171 5:179767503-179767525 TTTCTTTAGATCAACTTGTCGGG - Intronic
1004409913 6:15371576-15371598 AATCTTTACAGCAACTCCCCTGG - Intronic
1004979201 6:21003709-21003731 TTTCTTTAGAGCCACTAGCCTGG + Intronic
1011254880 6:85409918-85409940 TTTCTCTAGAGTAAATACGCAGG + Intergenic
1015636118 6:135276101-135276123 CTTCTTTAGATCAACTCACCAGG - Intergenic
1024807745 7:53166029-53166051 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
1025306524 7:57865503-57865525 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
1025318835 7:58068027-58068049 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
1025477251 7:60938635-60938657 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
1025482631 7:61002002-61002024 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
1025484606 7:61031186-61031208 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
1025554886 7:62295024-62295046 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
1025562745 7:62389832-62389854 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
1025877550 7:65498809-65498831 TTTCTTTAGTGGAATTCTGCTGG - Intergenic
1025986488 7:66457293-66457315 TTTCTTTAGAGGAAATACCCAGG - Intergenic
1026559397 7:71435705-71435727 GTTTTTTAGAGCAACTTCGGTGG - Intronic
1032443065 7:131957116-131957138 TTTCTTTACAGAAACTTCCCGGG + Intergenic
1032519599 7:132533887-132533909 GTCCTTTAGAGCAACCCCACAGG - Intronic
1033629094 7:143139668-143139690 TTTCTTTAGAGGAAATCACCTGG - Exonic
1040471799 8:47739978-47740000 TTTCTTTAGAGTTACTCAGAGGG + Intergenic
1047355623 8:124119021-124119043 TTTCTTTAGAGCAGCCCTGTGGG + Intronic
1051477266 9:17521844-17521866 ATTTTTTAGAGCAACTCTGAAGG - Intergenic
1056581799 9:87892868-87892890 TTTCTTTAGAGCAACTGTAAAGG + Intergenic
1058338689 9:103865898-103865920 TTTCTTTATAGCAAGTCTGTTGG - Intergenic
1203614028 Un_KI270749v1:37548-37570 TTTCTTTAGTGGAATTCTGCTGG + Intergenic
1195864618 X:109416078-109416100 GTTCTTTAGAGCAACACCACAGG + Intronic