ID: 1108057465

View in Genome Browser
Species Human (GRCh38)
Location 13:46498904-46498926
Sequence GTGGCCTTGCACACCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108057465_1108057477 29 Left 1108057465 13:46498904-46498926 CCTGGAGAGGTGTGCAAGGCCAC No data
Right 1108057477 13:46498956-46498978 CTTTGTGTCTGTGTTCTTATAGG No data
1108057465_1108057471 -4 Left 1108057465 13:46498904-46498926 CCTGGAGAGGTGTGCAAGGCCAC No data
Right 1108057471 13:46498923-46498945 CCACGGTTCCTTTTCAGGGGAGG No data
1108057465_1108057469 -7 Left 1108057465 13:46498904-46498926 CCTGGAGAGGTGTGCAAGGCCAC No data
Right 1108057469 13:46498920-46498942 AGGCCACGGTTCCTTTTCAGGGG No data
1108057465_1108057467 -9 Left 1108057465 13:46498904-46498926 CCTGGAGAGGTGTGCAAGGCCAC No data
Right 1108057467 13:46498918-46498940 CAAGGCCACGGTTCCTTTTCAGG No data
1108057465_1108057472 -3 Left 1108057465 13:46498904-46498926 CCTGGAGAGGTGTGCAAGGCCAC No data
Right 1108057472 13:46498924-46498946 CACGGTTCCTTTTCAGGGGAGGG No data
1108057465_1108057468 -8 Left 1108057465 13:46498904-46498926 CCTGGAGAGGTGTGCAAGGCCAC No data
Right 1108057468 13:46498919-46498941 AAGGCCACGGTTCCTTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108057465 Original CRISPR GTGGCCTTGCACACCTCTCC AGG (reversed) Intergenic
No off target data available for this crispr