ID: 1108058081

View in Genome Browser
Species Human (GRCh38)
Location 13:46505134-46505156
Sequence GCACCCTTCTCCTGGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108058081_1108058090 21 Left 1108058081 13:46505134-46505156 CCATCTCCCCAGGAGAAGGGTGC 0: 1
1: 0
2: 3
3: 28
4: 238
Right 1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG 0: 1
1: 0
2: 4
3: 2
4: 44
1108058081_1108058085 -6 Left 1108058081 13:46505134-46505156 CCATCTCCCCAGGAGAAGGGTGC 0: 1
1: 0
2: 3
3: 28
4: 238
Right 1108058085 13:46505151-46505173 GGGTGCACCTTCCCGATGCATGG 0: 1
1: 0
2: 1
3: 2
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108058081 Original CRISPR GCACCCTTCTCCTGGGGAGA TGG (reversed) Intergenic
900121607 1:1050714-1050736 GCTCCCTGCTCCTGGTGAGGAGG - Exonic
900179591 1:1305386-1305408 GCTGCCTTCTCCTGGGAGGATGG - Intronic
902482422 1:16718846-16718868 GCTCCCTTGTCCTGGGCTGAGGG + Intergenic
902654791 1:17859734-17859756 GCAGCCCTGTCCTGGGGAGTGGG - Intergenic
902742407 1:18448026-18448048 GCACCCTCTTTCTGGGTAGAAGG + Intergenic
902763156 1:18597553-18597575 GCACCCTTCTCCTTGGAATCAGG - Intergenic
902894288 1:19468341-19468363 GCTCCCTCCTGATGGGGAGAGGG + Intronic
903332709 1:22604129-22604151 GGACTCTGCTCATGGGGAGAGGG + Intergenic
903787012 1:25868064-25868086 GAAACCATCTCTTGGGGAGATGG - Intronic
903859086 1:26354394-26354416 GCATCCTTCCCCAGGGCAGAGGG - Intergenic
903976371 1:27153108-27153130 GAAACCTTCTTTTGGGGAGAAGG - Intronic
904009797 1:27383065-27383087 CCAGGCTGCTCCTGGGGAGACGG + Intronic
907181387 1:52573304-52573326 TGACCCTGCTCCTGAGGAGATGG + Intergenic
907517731 1:55003525-55003547 GCTCCATTCTGATGGGGAGAAGG - Intronic
908328826 1:63050545-63050567 GCAACATTCTCTTGGGCAGATGG + Intergenic
910522322 1:88136810-88136832 CCATCATTCTCCAGGGGAGATGG - Intergenic
910963674 1:92786579-92786601 GCTACCTTCACCTGGGGAGTGGG + Intronic
912949800 1:114112834-114112856 GCCAGTTTCTCCTGGGGAGAGGG + Intronic
913994984 1:143644233-143644255 GCTACCTTCACCTGGGGAGTGGG + Intergenic
914361177 1:146937788-146937810 GCTACCTTCACCTGGGGAGTGGG - Intergenic
914491410 1:148152835-148152857 GCTACCTTCACCTGGGGAGTGGG + Intergenic
914787047 1:150843214-150843236 GTATCCTTCTCCAGTGGAGAGGG - Intronic
915002117 1:152603161-152603183 CCACCCTGTTCCTGGGAAGACGG + Intergenic
915660654 1:157402648-157402670 TCACCCTTGACCTAGGGAGAGGG + Intergenic
916560548 1:165931094-165931116 TCACCCTTCTCCTGTCAAGATGG - Intergenic
918145963 1:181756066-181756088 CCATCCTTCCCCTGTGGAGACGG - Exonic
920504228 1:206505527-206505549 GTACACTTGTCCTGGGGAGAAGG + Intergenic
921339260 1:214118149-214118171 GCACCCATCTCCTGCAGAGTAGG + Intergenic
922619414 1:226980884-226980906 GCACCCGGCTCCGGGGCAGAGGG + Intronic
923509268 1:234635463-234635485 GCACCCTTCACCTGGAGACTCGG - Intergenic
1063267208 10:4466280-4466302 GCTCCATTCTTCTGTGGAGAAGG - Intergenic
1065831441 10:29618111-29618133 GCACTGTTCTCCTGGGGAGGCGG + Intronic
1067168118 10:43881693-43881715 GAGCCCTCCTCCTGGAGAGAGGG - Intergenic
1069794575 10:71043890-71043912 CCACCCTGCCCCAGGGGAGAAGG - Intergenic
1069925979 10:71851149-71851171 GGACCCTCATCCTGGGGAGGAGG - Intronic
1072276699 10:93830240-93830262 GCACCTTTAGCCTGGGGAAAAGG - Intergenic
1073482965 10:103798539-103798561 CCACTCTTTTCCTGGGGAGAGGG + Intronic
1074454515 10:113585781-113585803 GGACCCTTTTCCTGTGGGGAAGG - Exonic
1075389776 10:122083974-122083996 TCTCCCCTCTCCTGGGGTGATGG - Exonic
1075641340 10:124066765-124066787 GCACCTCCCTCCTGGGGAGGTGG + Intronic
1077206857 11:1348991-1349013 ACACACTTCTCATGGGGAGCTGG - Intergenic
1077490364 11:2858240-2858262 GAAGCCTTTTCCTGGGGAGCAGG - Intergenic
1078716548 11:13845165-13845187 GCATCCCTCTCCTGGGCACATGG + Intergenic
1079519195 11:21304772-21304794 GCACCCTACTGCAGGGGAAATGG - Intronic
1080018328 11:27531493-27531515 GAACCCTTCTCCTATGGACATGG + Intergenic
1080474041 11:32573231-32573253 GCTTCATTCCCCTGGGGAGAGGG + Intergenic
1080796144 11:35565430-35565452 GTACTCTTCTCCTAGTGAGAAGG + Intergenic
1084270833 11:68028243-68028265 TCACCCCTCTCCTGTGGAGCGGG + Exonic
1084377091 11:68784811-68784833 GCACCTGTCTCCTGCGGTGAGGG + Exonic
1085765283 11:79276811-79276833 CCACCCACATCCTGGGGAGAAGG + Intronic
1087819139 11:102691373-102691395 TCACCCTTCTCTTTGGGAGGTGG + Intergenic
1089123790 11:116162021-116162043 GCACCCGTCTCCTGGGGTTGAGG - Intergenic
1089195511 11:116692128-116692150 GCTCCCTTCAGCTGGGGGGATGG - Intergenic
1089403356 11:118178018-118178040 CCCCCATACTCCTGGGGAGATGG + Intergenic
1092132798 12:6124341-6124363 GATCCCTGCTCCTGGGGAGCTGG - Intronic
1092533897 12:9368152-9368174 CCACCGTGCTCCTGGGGAAACGG - Intergenic
1093545823 12:20346231-20346253 GCAGTCCTCTCCTGGAGAGAAGG - Intergenic
1094213647 12:27918744-27918766 CCACCCTTCCACTGGTGAGAGGG + Intergenic
1096473061 12:51890835-51890857 ACACCCCCCTCCTGAGGAGACGG - Exonic
1096809069 12:54158297-54158319 GCCCCCTTCTCCTGGTGGTAGGG - Intergenic
1098359856 12:69643777-69643799 GCATCTGTTTCCTGGGGAGAAGG + Intronic
1098592032 12:72225674-72225696 ACACCATTCTCCTTGGGAGGTGG + Intronic
1101739783 12:107491993-107492015 CTAGCCATCTCCTGGGGAGATGG - Intronic
1102680292 12:114686313-114686335 GCACCCTTCAGGTGGGGAGGAGG - Intergenic
1103219915 12:119235468-119235490 GAAAGCTTCTCCTGGTGAGATGG + Intergenic
1103724073 12:122989286-122989308 GCACCCTTGCCCTGGGGATCAGG - Intronic
1103885559 12:124197717-124197739 TGGCCCCTCTCCTGGGGAGATGG - Intronic
1104477223 12:129080909-129080931 GGCCCCTTCTGCTGGGGAGCGGG - Intronic
1105015337 12:132783336-132783358 CCAGCCTTCTCCTGGGGCCATGG + Intronic
1108058081 13:46505134-46505156 GCACCCTTCTCCTGGGGAGATGG - Intergenic
1110837465 13:80100969-80100991 CCACTCTTTTCCTGGGGAGAAGG + Intergenic
1111995736 13:95164632-95164654 ACACCCTTCTCCACAGGAGATGG - Intronic
1112539268 13:100291389-100291411 GGACCAATCCCCTGGGGAGATGG + Intronic
1114669128 14:24399495-24399517 CTCCCCTTCCCCTGGGGAGATGG + Intronic
1116593589 14:46811138-46811160 GGACCCTTCCCTTGGGGATAAGG - Intergenic
1119199779 14:72743766-72743788 GAGCCCTTTTCCTGGGGAGATGG + Intronic
1119263085 14:73249826-73249848 GGTCCCTTCTCCTGGGGATGGGG + Intronic
1124188354 15:27549756-27549778 GCACCCTTGTCCTGGGGTCATGG - Intergenic
1124973477 15:34513478-34513500 GCAGCCAGCCCCTGGGGAGAGGG + Intergenic
1125839264 15:42783471-42783493 ACATCCTTCTCCTGGGGACGGGG + Exonic
1126440873 15:48686896-48686918 ACATTCTTCTCCTGGGGACATGG + Intergenic
1126500126 15:49336210-49336232 CCACCTTTCTTCTGGGAAGATGG - Intronic
1128300698 15:66564821-66564843 GCAGGCTTCTCCTGGGGCGTGGG - Exonic
1128363783 15:66982449-66982471 CCAGCCTTCTGCTGGGGATAGGG - Intergenic
1128895261 15:71366923-71366945 TGACCCTTCTCCTTGGCAGAGGG + Intronic
1129119805 15:73389363-73389385 ACACCCTGCACCTGGGGAAAAGG - Intergenic
1129359821 15:75017830-75017852 GCTCCCGTCACCTGGGCAGAGGG - Intronic
1130193794 15:81760617-81760639 GCTCCCAGCTTCTGGGGAGAAGG - Intergenic
1132537076 16:487577-487599 GCCCCCTTCTCCTGGGCACGAGG + Intronic
1132618931 16:855333-855355 CTACCCTGCTCCAGGGGAGATGG - Intronic
1132696731 16:1205277-1205299 GGCCCCTCTTCCTGGGGAGAGGG - Intronic
1132761427 16:1510337-1510359 GCACTATTCTCCTGGTGACACGG - Exonic
1133357298 16:5146054-5146076 GCTGCGTTCTTCTGGGGAGATGG - Intergenic
1135418153 16:22284887-22284909 GCTCCCTTCTACTGTGGGGAAGG + Exonic
1135607195 16:23835554-23835576 GCACGCGTCTCCTGGAGGGATGG - Intergenic
1139952967 16:70680857-70680879 GCACGGTGGTCCTGGGGAGAGGG + Exonic
1141930010 16:87196057-87196079 GCACCCCTCTCCAGGGCTGAAGG + Intronic
1142410399 16:89913041-89913063 GCACTCATCTCCAGGGAAGATGG + Intronic
1143840154 17:9725413-9725435 GTACCCCTCCCCCGGGGAGATGG - Intronic
1144729576 17:17518760-17518782 GCATCGTTCTCCATGGGAGATGG - Intronic
1146058009 17:29590592-29590614 GCACTCTGCTTGTGGGGAGAGGG + Intronic
1146063183 17:29617609-29617631 GCAAACCTCTCCTGGGGGGAGGG + Exonic
1146912907 17:36659635-36659657 GGACCATTCTCCTGAGGAGTGGG + Intergenic
1147338855 17:39742240-39742262 GTGCCCTTGTCCTGGGGAGAGGG - Exonic
1147348474 17:39821507-39821529 GAACCCAACTCCTGGGGAGCTGG + Intronic
1147964615 17:44187382-44187404 GCACCCTTTTTCTGAGGCGAAGG - Intronic
1147972968 17:44229689-44229711 GGAACCTTCTCTTGGGGAGTTGG - Intergenic
1148208030 17:45791739-45791761 GCACCCTGCTTCTGGGGAGGAGG - Intronic
1148619185 17:49021878-49021900 GGACCCTTTAACTGGGGAGATGG + Intronic
1148863355 17:50616038-50616060 GGATCTTTCTCCTTGGGAGATGG - Intronic
1149478705 17:56984689-56984711 TCTCCCATCTCCTGGGGAGAGGG + Intronic
1149650981 17:58276338-58276360 GCAGCCTGCCCCAGGGGAGAGGG + Intronic
1151020286 17:70608344-70608366 TCACCCTTCTCCTGAGGTCAGGG + Intergenic
1151169949 17:72237480-72237502 GGAAGCTGCTCCTGGGGAGAGGG + Intergenic
1151362686 17:73598106-73598128 GCACCCTCCCCCTGGGGAGATGG - Intronic
1151458312 17:74239712-74239734 GCATCCATCTGCTGGGGAGTGGG - Intronic
1151850141 17:76685155-76685177 GAAGCCTTCTCCTGTGGAGGGGG + Exonic
1152015750 17:77749318-77749340 GCAGCCCTTTCCTGGGGAGCAGG - Intergenic
1152140763 17:78535045-78535067 GGACCCTTCTCCTGGGCAACAGG + Intronic
1152357104 17:79812746-79812768 GCACCCTTCTCCGGGCGCCAAGG - Intergenic
1152551236 17:81031385-81031407 GGACCCTTCTCTTGGAGAGAAGG + Intergenic
1153155622 18:2145907-2145929 CCAATCTTCTCCAGGGGAGAAGG - Intergenic
1153568530 18:6445038-6445060 ACCCCCTGTTCCTGGGGAGAGGG - Intergenic
1158901985 18:61972565-61972587 GCCTCCTTCTCCTGGGGTGCTGG - Intergenic
1160675786 19:390593-390615 GCACCCCAATGCTGGGGAGAAGG - Intergenic
1161572615 19:5038752-5038774 GCACCCATCTCCTGGGTGGGAGG - Intronic
1162565868 19:11445677-11445699 GTGCCCAGCTCCTGGGGAGAGGG - Intronic
1162964312 19:14148836-14148858 CCTCCCTTCTCCCGGGGAGCTGG - Exonic
1163777479 19:19226835-19226857 GCCCCCTTCTCCTAGGCATAGGG - Exonic
1164412413 19:28016929-28016951 GAACCCTTTTCCTGGGGTGTGGG - Intergenic
1166106060 19:40598544-40598566 GCACCTTTCTCCTGGTCAGGCGG + Intronic
1168347879 19:55659751-55659773 GCTCCCTTCTCCTGGGAGGCAGG - Intronic
1168366440 19:55792061-55792083 GCACCCTTCTCCATGTGATAAGG + Intronic
1168614477 19:57826737-57826759 GCACTCCTCTCCTGGGGAGATGG + Intronic
925368353 2:3326072-3326094 GCCCCCCTCTCCTGGGGGTAAGG + Intronic
926341776 2:11909931-11909953 GCAAACCTCTCCTGGGAAGAAGG + Intergenic
927241347 2:20922309-20922331 GCAGAATTCTCCTGGTGAGATGG - Intergenic
928127752 2:28628058-28628080 TCAGCCTCCTACTGGGGAGATGG + Intronic
935147010 2:100402500-100402522 GCACCCTTGTCGCGGGGAGCTGG - Intronic
935621532 2:105134522-105134544 GCACCATTCTCCTGGGGAGCTGG + Intergenic
938160489 2:128980759-128980781 GCAGCCTTATACTGGGGAGGTGG + Intergenic
938289184 2:130140485-130140507 GCACCCTGCTCAGTGGGAGAGGG - Intronic
938467342 2:131532453-131532475 GCACCCTGCTCAGTGGGAGAGGG + Intronic
938953916 2:136281614-136281636 GCTCCCTTCTAATGGGGAGATGG + Intergenic
939126511 2:138184155-138184177 GCAACCTTCTCCTGGGTTCAAGG + Intergenic
941856055 2:170232143-170232165 GTCACCTTCTCCTGGGGACAAGG + Intronic
942570354 2:177307933-177307955 ATATCCTTCTCCAGGGGAGAAGG + Intronic
943071978 2:183152375-183152397 GCACCCATCTCCTGAGCAGTAGG + Intronic
944471004 2:200054400-200054422 GCACCACTCTCATGGAGAGAAGG + Intergenic
946439173 2:219680506-219680528 GCAGCCCTCTCCTGGGCACAAGG - Intergenic
947610015 2:231518939-231518961 GCGCCCAAGTCCTGGGGAGAAGG - Intergenic
947713591 2:232329255-232329277 GCTCCCTTCTCCTCTGGGGACGG - Intronic
1169000424 20:2164086-2164108 GCTCCCTCATCCTGGGGAGGAGG + Intronic
1170928238 20:20745199-20745221 TCAGCCTCCTCCTGGGGCGATGG + Intergenic
1172034617 20:32002225-32002247 GCAGCCTTCTCCTCCAGAGAAGG - Exonic
1173447928 20:43137142-43137164 CCAACCTCCTCCTGAGGAGAAGG + Intronic
1175993097 20:62799197-62799219 GCACTCAGCTCCTGGGGAGGGGG - Intronic
1176104158 20:63377844-63377866 GGACGCCCCTCCTGGGGAGACGG + Intronic
1176217385 20:63954695-63954717 GCACCCTTCTCCAGGGGCCCCGG - Intronic
1179021486 21:37644937-37644959 GTGCCCTTCTCATGGGGAGGAGG + Intronic
1179727677 21:43349403-43349425 GCAGCCAGCTCCTGGGGGGAGGG + Intergenic
1180052048 21:45335742-45335764 CCACCCCTGGCCTGGGGAGATGG + Intergenic
1180148693 21:45936511-45936533 CCACCCCACACCTGGGGAGATGG - Intronic
1181943694 22:26498816-26498838 GCTCCTTTCTCCTGGGGGGTTGG - Intronic
1184066703 22:42125584-42125606 GCAGCCTTCTCGTTGGCAGAAGG + Intergenic
1184069171 22:42137736-42137758 GCAGCCTTCTCGTTGGCAGAAGG + Intergenic
1185279776 22:49965102-49965124 TCACCCTTCCCCTGGAGAGCAGG + Intergenic
950094940 3:10323607-10323629 GCACCCCCCTACTGGGGAGAGGG - Intergenic
950457497 3:13101435-13101457 GCACCCTTCTACTGTTGAGAGGG + Intergenic
951830048 3:26916526-26916548 GCAGCCATGTCCTGGGGAAAAGG - Intergenic
951928252 3:27934249-27934271 TCACTCTTCTCATTGGGAGAAGG + Intergenic
954442901 3:50531430-50531452 GCACCCTTCCCCTGCAGAGGGGG + Intergenic
954460275 3:50622633-50622655 GAACCCCTCTCCTGTGGAGAAGG - Intronic
958945002 3:100352954-100352976 TCACCCTTTTGTTGGGGAGAGGG - Intronic
959141236 3:102488988-102489010 TCACTGTTCTCATGGGGAGATGG - Intergenic
959418418 3:106104571-106104593 CCACCAAGCTCCTGGGGAGAGGG - Intergenic
960313454 3:116146123-116146145 GCTCCCTTCTTCTAGGGAGCAGG + Intronic
961455789 3:127023235-127023257 GCATCCTTCTGCTGGGGGGTGGG - Intronic
961691265 3:128671572-128671594 GCACCACTCTGCTGGGGATATGG - Intronic
962164952 3:133038717-133038739 GCACCCTCCACCTGGGGAGGGGG - Intronic
963129095 3:141841560-141841582 GCCCCCTCATGCTGGGGAGAAGG - Intergenic
963749011 3:149155631-149155653 GCAGCATTGTCCTGGGGGGAGGG + Intronic
964812823 3:160684001-160684023 GCACACTGCTCCTGAGAAGAAGG - Intergenic
966808207 3:183822596-183822618 GGAGCCTCCTCCTGGGGACATGG - Intronic
966870305 3:184286079-184286101 GCACATTTCACCTGGGGGGATGG + Intronic
967351250 3:188516132-188516154 GTACCCTTCTCCAGGGGAGGAGG - Intronic
968291649 3:197543841-197543863 GCACAGTGCCCCTGGGGAGAAGG + Intronic
968490665 4:889088-889110 GCAACCTGCACCTGGGGAGGTGG - Intronic
968744553 4:2352959-2352981 GCACCTGTCCCCTGGGCAGAAGG + Intronic
969696964 4:8740374-8740396 GCTCCCTTCCCCTGGGAGGAGGG - Intergenic
969701246 4:8768926-8768948 GCACCCTTCTCCTGTGGTGCTGG - Intergenic
969705230 4:8788173-8788195 GCAGCCCTCTCCTGGGGAGGTGG - Intergenic
970296186 4:14633292-14633314 GGACCCTCCTCCTATGGAGAGGG + Intergenic
971454397 4:26830416-26830438 GCACACTACTAGTGGGGAGATGG + Intergenic
975992055 4:80267360-80267382 GCACCCCTCTCCTGGGCATGAGG + Intronic
979183263 4:117756671-117756693 CCACCATTCTCCTCGTGAGAAGG - Intergenic
980325509 4:131339835-131339857 GCACACATCTCCTGGGGAGGAGG - Intergenic
981597984 4:146448941-146448963 GCAGCTTTCTCCTGTAGAGAAGG - Intronic
981751658 4:148098049-148098071 GCCCCAAACTCCTGGGGAGATGG + Intronic
982100957 4:151967451-151967473 GCAAGGTTCACCTGGGGAGAGGG - Intergenic
983933267 4:173476264-173476286 GCACCCTGCTCTTGGGGAATGGG + Intergenic
985940779 5:3134018-3134040 GCCCCCTTCCCCTGGGGTGGGGG + Intergenic
986053718 5:4114936-4114958 GAACCAGTCACCTGGGGAGATGG + Intergenic
991666487 5:69004930-69004952 ACACTCCTCTCCTGTGGAGAAGG + Intergenic
992499384 5:77327135-77327157 GCACACATTCCCTGGGGAGATGG + Intronic
992879691 5:81094948-81094970 GCAGCTTTCTCCTGGCGTGAGGG - Exonic
994078944 5:95684597-95684619 CCACTCTACTTCTGGGGAGAGGG - Intronic
997205676 5:132047839-132047861 GCAGCCTCCTCCTGAGTAGATGG - Intergenic
1001412348 5:171520295-171520317 GGGGCCATCTCCTGGGGAGATGG + Intergenic
1002177965 5:177412968-177412990 GCTCCTTCCTCTTGGGGAGAAGG + Intronic
1002261190 5:177995130-177995152 GCACCCCTCACCTGGGAAGATGG + Intronic
1002431821 5:179208380-179208402 GTACCGTTCACCTGGGGAGGGGG - Intronic
1003071074 6:2946176-2946198 CCATCCTTATCCTGGGGAAAGGG + Intergenic
1003094832 6:3133794-3133816 GTACCCGTCTCCTGGGGTGTAGG + Intronic
1003647371 6:7924698-7924720 GCAGTCTACTTCTGGGGAGAAGG + Intronic
1003687139 6:8315358-8315380 CTACCCAGCTCCTGGGGAGAGGG - Intergenic
1003895074 6:10599628-10599650 GCCCCCTACTCTTGGAGAGAGGG - Intronic
1005174823 6:23032921-23032943 ACATCCTTCTCATGAGGAGAAGG + Intergenic
1006376295 6:33673384-33673406 GCACCCTGGGCCTGGGGAGAGGG + Intronic
1006401748 6:33821758-33821780 GCCTCTTTCTCCTGGGGAGGTGG - Intergenic
1006410434 6:33870484-33870506 ATATCCTTCTGCTGGGGAGAGGG + Intergenic
1006580997 6:35078034-35078056 CCACCCTTCTCCCTGGGACAAGG + Intronic
1009396991 6:63211576-63211598 GCGCCAGTCTCCTGGGGAGATGG - Exonic
1010248958 6:73688646-73688668 GCACCCTCATCCTCTGGAGAGGG + Intergenic
1013307094 6:108859303-108859325 TCACCATCCTCCTGGGGAGACGG + Intronic
1013401687 6:109803009-109803031 ACCCCCTTCACATGGGGAGATGG + Intronic
1015620508 6:135127062-135127084 TCCCCCTTCTCCTAGGGATAGGG - Intergenic
1016539254 6:145145174-145145196 TCACCCCACTCCTGGGGAAAAGG + Intergenic
1017975449 6:159353098-159353120 GCTCCCTGATTCTGGGGAGAAGG - Intergenic
1019298829 7:292913-292935 GCACCCTTTGCCCAGGGAGAAGG + Intergenic
1022515014 7:30969807-30969829 CCAGCCCCCTCCTGGGGAGAGGG + Intronic
1022595253 7:31707404-31707426 GCATACATCTCCTGGGGAGAAGG - Exonic
1023254169 7:38296578-38296600 GGGTCCTTCTCCTGGGGATATGG - Intergenic
1023721385 7:43098998-43099020 GCACCTTTCTGCTGGGCTGAAGG + Intergenic
1023966656 7:44966345-44966367 CCACCCCACACCTGGGGAGATGG + Intronic
1024253665 7:47524150-47524172 GCAGCCGTCCCCTGGGGAGGCGG + Intronic
1024480219 7:49854927-49854949 GCACCCTGGTCCAGGGTAGAGGG + Intronic
1029442524 7:100595043-100595065 GCACCCATTTCCTAGGGATAAGG - Intronic
1029503198 7:100946533-100946555 TCACCAGGCTCCTGGGGAGATGG - Intergenic
1029507080 7:100969034-100969056 CAGCCCTTCTCCTGGGCAGAGGG - Intergenic
1038476270 8:27870682-27870704 GCACCCTCCTCCTAGAGACAGGG - Exonic
1041240927 8:55848383-55848405 GGAAGCTTCTCCTGGGGAGAAGG + Intergenic
1042648429 8:71013010-71013032 CCACCCTCCTCTTTGGGAGAAGG + Intergenic
1048997821 8:139805018-139805040 GGACCCCTCTCCAGGGGAGGGGG - Intronic
1049249369 8:141580000-141580022 GCTCTCTTTTCCAGGGGAGAGGG - Intergenic
1049607569 8:143536759-143536781 GCTCCTTTTTCCTGGGCAGATGG - Intronic
1050113857 9:2242781-2242803 GCACCATTCTAGTAGGGAGATGG - Intergenic
1053024219 9:34717071-34717093 GCATTCAGCTCCTGGGGAGAGGG + Intergenic
1053352717 9:37424194-37424216 GTACCCTGCTCATGGGGAGGTGG + Intronic
1053456873 9:38239955-38239977 GGACCCCTGTCCTGGGGAGTAGG - Intergenic
1054873957 9:70075974-70075996 GCACACTGTTCCTGGTGAGAGGG - Intronic
1055990679 9:82102302-82102324 GCACCCTTCTTGTGGAGGGAGGG + Intergenic
1055995550 9:82155185-82155207 GGGCCCTTTTCCTGGGGACATGG + Intergenic
1057265217 9:93612937-93612959 GCACCCTTCACGTGGAGCGATGG + Intronic
1062131169 9:134894065-134894087 GCCTCGTTCTCCTGGTGAGAGGG - Intergenic
1062269111 9:135700605-135700627 GCCCCAGTCTCCTGTGGAGAAGG + Intergenic
1062283058 9:135760434-135760456 GGACCCTGCTATTGGGGAGATGG + Intronic
1062434108 9:136538934-136538956 GCACCCTTTTGCTGTGGGGAGGG - Intronic
1188169087 X:26899993-26900015 ACAAGCTTCTCCTGGGAAGATGG + Intergenic
1189277264 X:39795920-39795942 TCACCCTCTTCCTGGGCAGAAGG + Intergenic
1190304193 X:49073059-49073081 GGACCCTAGGCCTGGGGAGAGGG - Intronic
1190572957 X:51803283-51803305 CCTCCCTTCTCCTCCGGAGATGG + Intronic
1191881788 X:65849727-65849749 GTACCCTTCTGCTGGGGCAAAGG - Intergenic
1192308799 X:69991634-69991656 GCTCCCTTCTGCTGGGTAGAGGG + Intronic
1192429218 X:71101285-71101307 GCACCCTTCTCCTGCTGACAGGG - Exonic
1192583995 X:72306227-72306249 GCCCGCTTCTCCCGGGGAGACGG - Intronic
1195044183 X:101041268-101041290 GCACCATTCTCCTGGAAAGGAGG + Intronic
1197714059 X:129693595-129693617 GTACCAGCCTCCTGGGGAGAGGG + Intergenic
1198800721 X:140445266-140445288 ACTCCCTTATCCTGTGGAGATGG + Intergenic
1200967369 Y:9109483-9109505 TCACCCTTCTCCTGTGGATGAGG + Intergenic