ID: 1108058082

View in Genome Browser
Species Human (GRCh38)
Location 13:46505140-46505162
Sequence GAAGGTGCACCCTTCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108058082_1108058090 15 Left 1108058082 13:46505140-46505162 CCCCAGGAGAAGGGTGCACCTTC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG 0: 1
1: 0
2: 4
3: 2
4: 44
1108058082_1108058091 27 Left 1108058082 13:46505140-46505162 CCCCAGGAGAAGGGTGCACCTTC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1108058091 13:46505190-46505212 CACTACACCGGTATGCTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1108058082_1108058092 30 Left 1108058082 13:46505140-46505162 CCCCAGGAGAAGGGTGCACCTTC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1108058092 13:46505193-46505215 TACACCGGTATGCTTGAAGGTGG 0: 1
1: 0
2: 3
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108058082 Original CRISPR GAAGGTGCACCCTTCTCCTG GGG (reversed) Intergenic