ID: 1108058082

View in Genome Browser
Species Human (GRCh38)
Location 13:46505140-46505162
Sequence GAAGGTGCACCCTTCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108058082_1108058091 27 Left 1108058082 13:46505140-46505162 CCCCAGGAGAAGGGTGCACCTTC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1108058091 13:46505190-46505212 CACTACACCGGTATGCTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1108058082_1108058090 15 Left 1108058082 13:46505140-46505162 CCCCAGGAGAAGGGTGCACCTTC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG 0: 1
1: 0
2: 4
3: 2
4: 44
1108058082_1108058092 30 Left 1108058082 13:46505140-46505162 CCCCAGGAGAAGGGTGCACCTTC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1108058092 13:46505193-46505215 TACACCGGTATGCTTGAAGGTGG 0: 1
1: 0
2: 3
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108058082 Original CRISPR GAAGGTGCACCCTTCTCCTG GGG (reversed) Intergenic
900702148 1:4055115-4055137 GAAGGGACTCCCTGCTCCTGGGG - Intergenic
901954356 1:12773161-12773183 GAAGGTTCAGGCTTCTCCGGAGG - Intergenic
902282392 1:15384109-15384131 GAGGGGGCACCCTTCTCTGGGGG - Intronic
903034913 1:20486829-20486851 TGAGGCGCTCCCTTCTCCTGCGG - Intergenic
903700776 1:25246905-25246927 GAGGGCGAATCCTTCTCCTGCGG + Exonic
904014812 1:27411210-27411232 AAAGGTGCACTTTTCTCCTTGGG - Intronic
905482783 1:38272914-38272936 GAGGGTGTCCCCTTTTCCTGAGG - Intergenic
905638994 1:39576006-39576028 GAAGGCGCCCCTTTGTCCTGCGG - Exonic
921345551 1:214180669-214180691 GAAGGTACACCATACTCCAGGGG + Intergenic
924101786 1:240611383-240611405 CAAGGTGCACCCGCCTCATGAGG - Intronic
1067777431 10:49173704-49173726 GAAGCTGGACTCTTCTCCTGGGG + Intronic
1068423160 10:56822180-56822202 TCAGGTGCACCTTTTTCCTGTGG - Intergenic
1069159682 10:65078570-65078592 GAAGGTGCCTGCTTCTCCTTTGG + Intergenic
1070993162 10:80750848-80750870 GAAATTGCACCCTTGCCCTGTGG + Intergenic
1071335869 10:84600156-84600178 GGAGGGCCACCCTTCTCCAGAGG - Intergenic
1071960004 10:90801026-90801048 AAAGCTGCTCTCTTCTCCTGAGG + Intronic
1074875510 10:117610357-117610379 GAGGCTGCACCCTTCTCCCCAGG + Intergenic
1075674140 10:124284099-124284121 GAGGGTGCTCCATTGTCCTGGGG - Intergenic
1076388451 10:130076485-130076507 GAGGGTGGCCCCTTCTCCAGAGG + Intergenic
1077674139 11:4182348-4182370 GAAGGTGCAGCCTGTGCCTGTGG + Intergenic
1078526002 11:12101986-12102008 AAAGGTGCAACCTTCTTCTAAGG - Intronic
1081176414 11:39932619-39932641 GAAGCTGAAGCCCTCTCCTGTGG - Intergenic
1083270800 11:61571621-61571643 GAAGGTGCCCGCTTCTGCTAGGG - Intronic
1083840708 11:65302564-65302586 GAAGGTCCACTTTCCTCCTGAGG + Intronic
1085221190 11:74874929-74874951 GAAAGTGCACCCCTCTCCCCAGG + Intronic
1087686969 11:101275964-101275986 AAAGGTGCTCCCTTCTCCTTTGG - Intergenic
1088683974 11:112269569-112269591 GGAGATGAACCCTGCTCCTGTGG + Intronic
1090187136 11:124746087-124746109 GAAAATGCACCCTGCCCCTGCGG + Intronic
1090513229 11:127397568-127397590 GGAGGTGCATTCTTCTCATGGGG + Intergenic
1091308963 11:134559598-134559620 GGAAGTGCTCCCTTCTCCAGAGG + Intergenic
1091612535 12:2023490-2023512 GCAGGTGGAAGCTTCTCCTGGGG - Intronic
1092259554 12:6945733-6945755 GAAGGTCAACCCTTCTCCTAAGG - Intronic
1098225066 12:68312830-68312852 GCAGGTACCCCCTTCACCTGAGG + Intronic
1102401208 12:112631113-112631135 GCAGCTGTACCCTTGTCCTGTGG + Intronic
1103067603 12:117913130-117913152 GGTGGAGCACCCTTCTTCTGAGG - Intronic
1103854273 12:123954853-123954875 GCTGGTGCTCCCTCCTCCTGGGG - Intronic
1108058082 13:46505140-46505162 GAAGGTGCACCCTTCTCCTGGGG - Intergenic
1110134952 13:72055306-72055328 CTATGTACACCCTTCTCCTGTGG + Intergenic
1113743098 13:112724658-112724680 GAAGCTGCAGCCCTGTCCTGGGG + Intronic
1114468362 14:22941038-22941060 TGAGGGGCACCCTTCTCCTTTGG + Intergenic
1115446307 14:33494388-33494410 GAAGGCGTAGCCTTCTCCTTTGG - Intronic
1117287073 14:54296289-54296311 GAAGCTGTACCTTTCTTCTGAGG - Intergenic
1119735935 14:76982103-76982125 TAGGGTGCTCCCTGCTCCTGGGG - Intergenic
1120061594 14:79989778-79989800 GAAGCTTCACCTTTCTGCTGGGG - Intergenic
1120645510 14:87069663-87069685 GCAGGTACAGCCTTTTCCTGAGG + Intergenic
1120799904 14:88676327-88676349 GAAGGTGCCTGCTTCTCCTTTGG - Intronic
1121270901 14:92637552-92637574 GCAGGTCCTCCCTTCTCCAGAGG - Intronic
1122082316 14:99274378-99274400 GGAGGGGCTCCCTTTTCCTGAGG - Intergenic
1123783461 15:23647187-23647209 GATGGTGCATCCTCCTCCTCCGG - Exonic
1125265340 15:37872944-37872966 AAATGAGCGCCCTTCTCCTGGGG - Intergenic
1128459164 15:67853087-67853109 GAAGTGGCACCATTCGCCTGGGG + Intergenic
1128495408 15:68195626-68195648 GTGGGTGAAGCCTTCTCCTGAGG - Intronic
1129430727 15:75499811-75499833 GAGGATGCACACTTATCCTGGGG - Intronic
1130043116 15:80421720-80421742 GAAGGTGCACCTTTTTCCTAGGG + Intronic
1130986169 15:88845950-88845972 GAAGGTACAGCCTTCAACTGCGG - Intronic
1131077760 15:89506526-89506548 GAAGGAGTTCCCTTCTCCTTCGG - Intergenic
1133212382 16:4270872-4270894 GAACTTGAACCCTTGTCCTGGGG - Intronic
1134628425 16:15739494-15739516 GAAGGAGGACCCTTCCCTTGTGG - Intronic
1136667485 16:31825046-31825068 AAAGATGCACCTTTTTCCTGTGG + Intergenic
1139527339 16:67525044-67525066 GAGGCTGCTCCTTTCTCCTGTGG + Intronic
1140992735 16:80229969-80229991 AGAGGAGCACCCTACTCCTGTGG + Intergenic
1141093890 16:81149057-81149079 GATGGTGCTGACTTCTCCTGAGG - Intergenic
1141107190 16:81243290-81243312 AAAGGTGCCCCATTCTTCTGAGG + Intronic
1141382519 16:83588943-83588965 GAAGGTGTACTCGTTTCCTGTGG + Intronic
1141842981 16:86586255-86586277 GAGGCTCCACCCCTCTCCTGGGG + Intergenic
1142499571 17:324598-324620 CATGCTGCACCCTTCACCTGGGG + Intronic
1147414419 17:40278245-40278267 GAAGGTCCATCCTTTTCCTGAGG - Exonic
1150001931 17:61445918-61445940 GAATGAGCACCCCACTCCTGGGG + Intergenic
1150135668 17:62693595-62693617 GAAGGTTCTGCCTTGTCCTGTGG + Exonic
1151326566 17:73383441-73383463 GAAGGAGCACCCTGCCCTTGAGG - Intronic
1151850137 17:76685149-76685171 GAAGGAGAAGCCTTCTCCTGTGG + Exonic
1152274891 17:79350376-79350398 GATGGGTCTCCCTTCTCCTGGGG + Intronic
1152285131 17:79408134-79408156 GAAGGAGCACTCGCCTCCTGGGG + Intronic
1153636295 18:7116924-7116946 CAAGGTGCTCCCTTCTCCGCTGG + Intronic
1160389157 18:78517528-78517550 GAGGGACCACCCTTCTGCTGTGG + Intergenic
1163454750 19:17399918-17399940 GAAGGCCCACCCTGCTCCCGGGG + Intergenic
1163520570 19:17789197-17789219 CAAGGTCCACCCTCCTCCTGGGG - Intergenic
1167686158 19:50958035-50958057 GAGGCTGAAACCTTCTCCTGAGG - Intergenic
1168614476 19:57826731-57826753 GAAGGTGCACTCCTCTCCTGGGG + Intronic
925195145 2:1917005-1917027 CATGGTGCACCACTCTCCTGGGG + Intronic
925314659 2:2912008-2912030 GAATGTGCTCCTTCCTCCTGGGG - Intergenic
929776779 2:44935120-44935142 GAAGAGGCGCCCTTCCCCTGGGG - Intergenic
932526198 2:72471758-72471780 GAATGAGCATCCTTGTCCTGGGG + Intronic
932590413 2:73062908-73062930 GAAGCTGCACCAGACTCCTGTGG + Intronic
934950520 2:98572364-98572386 GAAAGTGCAGCCTCCTCCAGGGG - Intronic
937434249 2:121867268-121867290 GAAGGTGGAGGCTTCTCATGAGG - Intergenic
937543351 2:122986395-122986417 GAAGGTGCCTGCTTCTCCTTTGG + Intergenic
938304835 2:130246080-130246102 GAAGGTTCTCCCTCCTCCTGTGG + Intergenic
938449178 2:131401120-131401142 GAAGGTTCTCCCTCCTCCTATGG - Intergenic
943845059 2:192634943-192634965 TCTGGTGCCCCCTTCTCCTGTGG - Intergenic
944316005 2:198286476-198286498 CAAGGGGCACCCGTCTCCTGCGG - Intronic
1169936893 20:10893355-10893377 AAAGGGGCCCCTTTCTCCTGAGG + Intergenic
1170555831 20:17513960-17513982 GAGGCTGCTCCCTGCTCCTGGGG + Intronic
1172067755 20:32233689-32233711 AAAGGTGAGCCCTTCTCTTGAGG - Intronic
1173167063 20:40692767-40692789 GAAGGTGCGCCGTTCACCTTCGG + Intergenic
1173845980 20:46189089-46189111 GCAGGTGCAGCCACCTCCTGGGG + Intronic
1173939890 20:46901714-46901736 AAAGGTGCACGATTCTCCTCGGG - Intronic
1175275664 20:57768860-57768882 GAAGGTGCCTGCTTCTCCTTTGG + Intergenic
1181509891 22:23384487-23384509 GAAGGTGAGACCTTCTTCTGAGG + Intergenic
950880462 3:16318836-16318858 GAAGCTCCACCCATCTCCTAAGG - Intronic
954422420 3:50425714-50425736 GATGGTGCCCACTTCTCCGGGGG - Intronic
956435707 3:69232664-69232686 GCAGGTGCACCCATTTGCTGGGG - Intronic
956674493 3:71721677-71721699 GAAGGTGCCTGCTTCTCCTTTGG + Intronic
959474011 3:106787647-106787669 GAAAGTGCACCTATCTCTTGAGG + Intergenic
960926548 3:122800179-122800201 GAAGCTCCACCCTTCTCCACAGG - Intronic
967073768 3:185983983-185984005 GAAGGCTCACCCTTAGCCTGAGG - Intergenic
968454339 4:689339-689361 GAAGTTGGACCCTCCTCCTTCGG + Exonic
969522515 4:7686811-7686833 GACGGCTCCCCCTTCTCCTGGGG - Intronic
969695655 4:8732830-8732852 GAGGCTGAGCCCTTCTCCTGTGG - Intergenic
969701247 4:8768932-8768954 CTAAGGGCACCCTTCTCCTGTGG - Intergenic
969717357 4:8874185-8874207 GACCGTGCACCCTTTTCCTCTGG + Intergenic
970872224 4:20829157-20829179 GAAGGTCCAGTCTTCTCCAGTGG + Intronic
975220551 4:71808557-71808579 ACAGGGGCACCCTTCCCCTGTGG - Intergenic
975455736 4:74587675-74587697 GAGAGTGCAGCCTTCTCCTATGG + Intergenic
979614923 4:122732388-122732410 GAAGCTGTAACCTTCTGCTGGGG - Intergenic
981549854 4:145932796-145932818 GACGATGCAGGCTTCTCCTGAGG - Intronic
985071540 4:186170695-186170717 GAAAGGGCCTCCTTCTCCTGAGG - Intronic
986136651 5:4986136-4986158 GAAGCTGCTCCCTTCCCCTTGGG + Intergenic
986170178 5:5308505-5308527 GAGGGTGCTCCCTCCTCCTTGGG - Intronic
988465436 5:31486654-31486676 GAAGGTGAAGCCTTCTCATTTGG - Intronic
989536680 5:42572306-42572328 GAAGGTGCACCCTTTTGTTGTGG - Intronic
991073365 5:62511576-62511598 GAATTTGCTCCCCTCTCCTGTGG - Intronic
994022693 5:95045790-95045812 GAAGGAGCACTCTTATCTTGAGG - Intronic
996575455 5:124972836-124972858 GAAGATGGCCCCTTCTTCTGGGG + Intergenic
1003037975 6:2661748-2661770 GAAGCTGCACCCTTGTCGGGGGG + Intergenic
1006413311 6:33888355-33888377 GAAGTTGCACCTTTCTCGGGGGG - Intergenic
1009396992 6:63211582-63211604 GAAGGTGCGCCAGTCTCCTGGGG - Exonic
1010173222 6:72996964-72996986 GAAGGAGCACACGTCTTCTGTGG + Intronic
1013235606 6:108195453-108195475 GAAGGTCAGCCCTTGTCCTGGGG - Intergenic
1019517222 7:1445362-1445384 GAAGGTGCCCGGCTCTCCTGTGG + Exonic
1019607483 7:1917411-1917433 GGAGGTGCGCCCTTCACCCGGGG - Intronic
1024475030 7:49800541-49800563 GATGGTGCTCCCCTCCCCTGGGG + Intronic
1024668006 7:51565012-51565034 TAAGGTGGCCCCTCCTCCTGTGG + Intergenic
1024768005 7:52684332-52684354 GGAGGTGCCCTCTTCTCTTGAGG - Intergenic
1029175637 7:98662539-98662561 GAGGGTGCACCTGTTTCCTGGGG - Intergenic
1033236683 7:139643492-139643514 GCAGATGCAACCTTCTCCTCTGG - Intronic
1035686898 8:1530208-1530230 CCAGGTGCACCTGTCTCCTGTGG - Intronic
1036296637 8:7543085-7543107 GAAGCTGCACCCACCTCCAGGGG - Intergenic
1036325929 8:7777934-7777956 GAAGCTGCACCCACCTCCAGGGG + Intergenic
1041145765 8:54874731-54874753 GAAGATGCACCCTTCCTCTTAGG - Intergenic
1047554992 8:125919680-125919702 AATGCTACACCCTTCTCCTGGGG - Intergenic
1051279855 9:15431341-15431363 GAAGGAGCACCCTACCCCTAGGG - Intronic
1055682151 9:78726713-78726735 GAAGGTGCCTGCTTCTCCTTTGG - Intergenic
1057599870 9:96448987-96449009 GAAGGGGCCCTCTTCCCCTGGGG + Intergenic
1186766535 X:12776242-12776264 GAGGCTGCCCCCTTTTCCTGGGG - Intergenic
1191101116 X:56729530-56729552 GAAGTCGCACCCTCCTCCTCCGG + Intergenic
1191881789 X:65849733-65849755 GAATGGGTACCCTTCTGCTGGGG - Intergenic
1200967368 Y:9109477-9109499 GCTTGTTCACCCTTCTCCTGTGG + Intergenic