ID: 1108058083

View in Genome Browser
Species Human (GRCh38)
Location 13:46505141-46505163
Sequence GGAAGGTGCACCCTTCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108058083_1108058091 26 Left 1108058083 13:46505141-46505163 CCCAGGAGAAGGGTGCACCTTCC 0: 1
1: 0
2: 2
3: 13
4: 151
Right 1108058091 13:46505190-46505212 CACTACACCGGTATGCTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1108058083_1108058092 29 Left 1108058083 13:46505141-46505163 CCCAGGAGAAGGGTGCACCTTCC 0: 1
1: 0
2: 2
3: 13
4: 151
Right 1108058092 13:46505193-46505215 TACACCGGTATGCTTGAAGGTGG 0: 1
1: 0
2: 3
3: 2
4: 39
1108058083_1108058090 14 Left 1108058083 13:46505141-46505163 CCCAGGAGAAGGGTGCACCTTCC 0: 1
1: 0
2: 2
3: 13
4: 151
Right 1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG 0: 1
1: 0
2: 4
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108058083 Original CRISPR GGAAGGTGCACCCTTCTCCT GGG (reversed) Intergenic
900702149 1:4055116-4055138 GGAAGGGACTCCCTGCTCCTGGG - Intergenic
900725793 1:4215744-4215766 GGAAGTTGGACACTTCTTCTGGG - Intergenic
900883662 1:5400640-5400662 GGAAATGGCACCTTTCTCCTTGG - Intergenic
901529121 1:9842714-9842736 GTGAGGGGCACACTTCTCCTTGG - Intergenic
902282393 1:15384110-15384132 GGAGGGGGCACCCTTCTCTGGGG - Intronic
902629175 1:17694737-17694759 GGGAGGTGCAAGCTTCTCATCGG - Intronic
902705663 1:18202536-18202558 AGAAGGTGCTTGCTTCTCCTTGG - Intronic
902791605 1:18772441-18772463 GGAAGGTGCTTCCTTGTCATGGG + Intergenic
903256611 1:22106484-22106506 GGAAGGTTCACCTTTTCCCTGGG + Intergenic
904014813 1:27411211-27411233 GAAAGGTGCACTTTTCTCCTTGG - Intronic
907617982 1:55944192-55944214 GCCAGGTGCACCCTTTTCCAAGG - Intergenic
919613536 1:199776794-199776816 GGAAGGGGCATCTTTCTCCAAGG + Intergenic
922565357 1:226597986-226598008 GGAAGCTGCTCCTTCCTCCTGGG + Intronic
923131318 1:231077172-231077194 GGACGGTGCACCATTGTCATTGG + Intergenic
923942758 1:238845685-238845707 GGTAGGTGCACCCAGCTGCTGGG - Intergenic
1062958509 10:1556134-1556156 GGAAGGTGCCCCCTCATCCTGGG - Intronic
1063024242 10:2162358-2162380 GGAACGTGCACCGTTCACCTAGG + Intergenic
1063248853 10:4252239-4252261 GGAAGATTCACCCCTGTCCTAGG - Intergenic
1063971531 10:11384634-11384656 GGGGGGTCCACCCTCCTCCTAGG + Intergenic
1064863236 10:19850245-19850267 GGCAGGTGCAGTTTTCTCCTAGG - Intronic
1067284208 10:44895550-44895572 AGCAGGTGCATCCTTCTCCTGGG - Intergenic
1067777430 10:49173703-49173725 GGAAGCTGGACTCTTCTCCTGGG + Intronic
1069890012 10:71646783-71646805 GGAAGGGGCTCCCTTGACCTAGG + Intronic
1070772086 10:79088428-79088450 GGGAGGGCCACCCTTCTGCTGGG + Intronic
1075786417 10:125053180-125053202 GGCAGGTGCAGCATTCTCCCAGG + Intronic
1075832076 10:125419963-125419985 GGAGGGAGCACCTTTCTCCCAGG - Intergenic
1076569232 10:131421409-131421431 GGATGATGCTCCCTTCTCATAGG + Intergenic
1076889245 10:133275892-133275914 GGAAGGTTCATCCTTGCCCTCGG - Intronic
1083270801 11:61571622-61571644 AGAAGGTGCCCGCTTCTGCTAGG - Intronic
1083418589 11:62541017-62541039 GGAAGGGGCACTGTTCTCCGAGG - Intronic
1083765655 11:64840294-64840316 GCCAGGTGCACCCTTCCCCCGGG - Intronic
1086638820 11:89125912-89125934 GGTTGGAGCACCCATCTCCTTGG + Intergenic
1088133369 11:106523322-106523344 GGCAGGTGGATCCTCCTCCTGGG + Intergenic
1091319561 11:134640076-134640098 GGGAGCCGCACCCTTCTCCAGGG - Intergenic
1091612536 12:2023491-2023513 GGCAGGTGGAAGCTTCTCCTGGG - Intronic
1091688770 12:2581866-2581888 GGAAGCTGCACCCTTTTACCGGG + Intronic
1095422407 12:42039178-42039200 GGAAGCCCCATCCTTCTCCTTGG - Intergenic
1097159471 12:57036157-57036179 GGTAGCTGCCCTCTTCTCCTAGG + Intronic
1103384596 12:120522245-120522267 GGAAGATGCACCCGCTTCCTGGG - Exonic
1104273237 12:127301566-127301588 GGAAATTGCACGTTTCTCCTTGG - Intergenic
1104862249 12:131929759-131929781 GGACGGTGGACCCTGCGCCTGGG + Exonic
1106282394 13:28287142-28287164 CGAAGGAGCATCCTTCTTCTGGG + Intronic
1108058083 13:46505141-46505163 GGAAGGTGCACCCTTCTCCTGGG - Intergenic
1110243914 13:73300083-73300105 TGAAGGAGCTCCCTTCTTCTAGG + Intergenic
1110369591 13:74725176-74725198 GGAAGGTGTTAGCTTCTCCTAGG + Intergenic
1111725278 13:92000138-92000160 TGCTTGTGCACCCTTCTCCTGGG + Intronic
1113743097 13:112724657-112724679 GGAAGCTGCAGCCCTGTCCTGGG + Intronic
1117338321 14:54773638-54773660 GGCAGGTCCATGCTTCTCCTGGG - Intronic
1117836412 14:59811115-59811137 AGGAGGTTCACCCTTCCCCTGGG - Intronic
1119350193 14:73958241-73958263 GGAAGGTGCTGCCATCACCTAGG - Exonic
1119804681 14:77475138-77475160 GGAAGGGCCACTCTTCTCATGGG - Exonic
1119861892 14:77942065-77942087 GGAACCTGAGCCCTTCTCCTTGG - Intergenic
1120061595 14:79989779-79989801 GGAAGCTTCACCTTTCTGCTGGG - Intergenic
1120714097 14:87821916-87821938 GTGAGGTGCACCCTTACCCTTGG - Intergenic
1120881841 14:89419707-89419729 GGGAGGGGCGCTCTTCTCCTTGG - Intronic
1121262025 14:92573346-92573368 GGAAGATGCACCCAGCTTCTAGG - Intronic
1122131785 14:99608250-99608272 GGAAGCTGGACCCTTTCCCTGGG + Intergenic
1122227679 14:100289257-100289279 GGAGATTGCATCCTTCTCCTAGG - Intergenic
1122406834 14:101505766-101505788 GGAAGCTGGAACCCTCTCCTGGG - Intergenic
1122946626 14:105013921-105013943 GGAAAATGTACCCTTCACCTGGG + Intronic
1123891628 15:24786295-24786317 GGAAGGCTCCCCCTTCTCATTGG - Intergenic
1130043115 15:80421719-80421741 GGAAGGTGCACCTTTTTCCTAGG + Intronic
1131163683 15:90126978-90127000 GGAAGGGGCTGCCTGCTCCTAGG + Intergenic
1132680806 16:1141004-1141026 GGAAGGTGCATCCTCCTTCCTGG + Intergenic
1132915011 16:2339580-2339602 GAGAGGTTCACTCTTCTCCTGGG - Intronic
1133212383 16:4270873-4270895 GGAACTTGAACCCTTGTCCTGGG - Intronic
1133824639 16:9267175-9267197 ACAAGATGCCCCCTTCTCCTTGG + Intergenic
1135247459 16:20869174-20869196 GGAAGTTGTTCCCATCTCCTAGG + Intronic
1139660433 16:68417018-68417040 GGCTGGTGCACCCATCCCCTGGG + Intronic
1141089736 16:81121935-81121957 GGAAGGTTCTCCCCTCCCCTCGG + Intergenic
1142709885 17:1717199-1717221 GGAAGGAGCAGCCTGCTCATTGG - Intronic
1147040562 17:37715122-37715144 GGAAGGAGCAGCCATCTCCCAGG - Intronic
1152573158 17:81129224-81129246 GGAAGGAGCCCCCTCCCCCTGGG - Intronic
1159984663 18:74828028-74828050 CTCAGGTGCTCCCTTCTCCTGGG + Intronic
1161778083 19:6274719-6274741 GGAAGGTTCCCCTTTATCCTGGG - Intronic
1163012469 19:14434161-14434183 GTCAGGTGGAACCTTCTCCTGGG + Intronic
1163520571 19:17789198-17789220 CCAAGGTCCACCCTCCTCCTGGG - Intergenic
1164793657 19:31008906-31008928 GGAAGTTATACCCTTCTTCTAGG - Intergenic
1166096535 19:40542705-40542727 TGAATGTGCACTCCTCTCCTAGG - Intronic
1168565597 19:57419650-57419672 GGAAGGTGCCTCCTCATCCTTGG - Exonic
1168614475 19:57826730-57826752 GGAAGGTGCACTCCTCTCCTGGG + Intronic
925314660 2:2912009-2912031 GGAATGTGCTCCTTCCTCCTGGG - Intergenic
926199098 2:10780555-10780577 GGAGGGTGTACCCAGCTCCTGGG + Intronic
926714345 2:15912296-15912318 GGAAGAAGCAGCCTTCCCCTGGG + Intergenic
927970710 2:27304862-27304884 GGAAGGGCCAGCCCTCTCCTAGG + Intronic
928312510 2:30222559-30222581 GGAAGGTCCCCCCTACCCCTGGG + Intergenic
929776780 2:44935121-44935143 GGAAGAGGCGCCCTTCCCCTGGG - Intergenic
930274239 2:49293120-49293142 AGAAGGTGCCTGCTTCTCCTTGG + Intergenic
934950521 2:98572365-98572387 GGAAAGTGCAGCCTCCTCCAGGG - Intronic
936117819 2:109716028-109716050 GAAAGGTGTACCTTTCTCCTGGG - Intergenic
940321730 2:152384620-152384642 GAAAGGTGGACTCTTCTCCTCGG + Intronic
944307232 2:198192692-198192714 TGAAGGTGCCTCCTTCACCTGGG + Intronic
1169459505 20:5782066-5782088 GGAATGTGCCCCCTCCTCCCTGG + Intronic
1170686694 20:18575973-18575995 GGAGAGAGGACCCTTCTCCTGGG - Intronic
1172169858 20:32923056-32923078 GCACGGTGCACCCAGCTCCTTGG + Intronic
1173178216 20:40781441-40781463 GGAAGAGGCTGCCTTCTCCTGGG + Intergenic
1173227805 20:41172126-41172148 GGCAGGGGCTTCCTTCTCCTGGG + Intronic
1173389705 20:42621185-42621207 GCAAGGTGCATCCTTCCCCCTGG + Intronic
1173570078 20:44070296-44070318 GGAAACTGCACCCCACTCCTGGG - Intergenic
1173845979 20:46189088-46189110 GGCAGGTGCAGCCACCTCCTGGG + Intronic
1173939891 20:46901715-46901737 CAAAGGTGCACGATTCTCCTCGG - Intronic
1175500604 20:59447720-59447742 GGAAGGAGGACCCTTCTTCAAGG - Intergenic
1176151654 20:63594504-63594526 GGAGGCCTCACCCTTCTCCTGGG - Intronic
1182295936 22:29311305-29311327 GGAAGCTGCTCACTTCTCCCTGG + Intronic
1183214637 22:36471484-36471506 GGATGTTGCAACCTCCTCCTCGG + Intronic
1184257870 22:43297248-43297270 GTAGGCTGCACACTTCTCCTGGG + Intronic
959190322 3:103103208-103103230 GGCATGTGAACACTTCTCCTAGG - Intergenic
959278836 3:104311359-104311381 GGAATCTGAACCCTTCTCTTTGG - Intergenic
967724455 3:192848864-192848886 GGAAAGTGCTCGCTTCCCCTTGG + Intronic
968494305 4:906962-906984 TAAACGTGCACCCTTCTCCTGGG + Intronic
968879227 4:3290689-3290711 AGCAGGTGCACGCTTCTCCATGG + Intergenic
968885751 4:3330917-3330939 GGAAGTTGCACACATCTCATTGG + Intronic
971920671 4:32935045-32935067 GAAAGGTGCTCCTTTCCCCTGGG + Intergenic
971985452 4:33816788-33816810 GGAAGTTGCAACATTCTACTAGG - Intergenic
986136650 5:4986135-4986157 GGAAGCTGCTCCCTTCCCCTTGG + Intergenic
986170179 5:5308506-5308528 GGAGGGTGCTCCCTCCTCCTTGG - Intronic
987816097 5:22902177-22902199 GACAGGTGCCCCCTGCTCCTGGG - Intergenic
999381682 5:151125855-151125877 GGAAGGTGCCCCCTCCCTCTGGG - Intronic
1000788010 5:165570392-165570414 GCAAGGTACAGCCTTCTCCGTGG + Intergenic
1001141033 5:169144246-169144268 GGAAGGAGCATTCTGCTCCTAGG - Intronic
1002134527 5:177099561-177099583 GACAGGTGCACCCTACTCATGGG - Intergenic
1003037974 6:2661747-2661769 GGAAGCTGCACCCTTGTCGGGGG + Intergenic
1004455112 6:15785003-15785025 GGAAGGTGCCCATTTCTCCCTGG - Intergenic
1004563179 6:16770805-16770827 GGAGGGTGCATTCGTCTCCTAGG - Intergenic
1005882612 6:30072432-30072454 GGTAGAGGCACCCTTCTTCTTGG + Intronic
1006413312 6:33888356-33888378 GGAAGTTGCACCTTTCTCGGGGG - Intergenic
1006735145 6:36268056-36268078 GGATGGTGGCCCATTCTCCTAGG - Intronic
1009396993 6:63211583-63211605 GGAAGGTGCGCCAGTCTCCTGGG - Exonic
1009878543 6:69536649-69536671 GGAAAGTATACTCTTCTCCTTGG + Intergenic
1010011998 6:71058680-71058702 GGAAGGTGCCCCCTTTCCCTGGG + Intergenic
1010579833 6:77582074-77582096 GGAACTTGCCCCCTTCTCCAAGG - Intergenic
1011155016 6:84321086-84321108 GGAGGTTGCACTCTTTTCCTTGG + Intergenic
1013235607 6:108195454-108195476 GGAAGGTCAGCCCTTGTCCTGGG - Intergenic
1015196798 6:130532414-130532436 GGAAGGGGCTCCCTTCTCATTGG + Intergenic
1015559293 6:134497213-134497235 GGCAGGTTCACCCTTCTTCATGG - Intergenic
1016258999 6:142145255-142145277 GGAGGGTGCAGCCTTCTACCAGG + Intergenic
1018383945 6:163285647-163285669 GGACGGTGCATTCTTTTCCTTGG - Intronic
1019162749 6:170080195-170080217 GGGAGGTGCATCCTTCTGGTAGG - Intergenic
1019512204 7:1423258-1423280 TGGGGGTGCCCCCTTCTCCTTGG - Intergenic
1019607484 7:1917412-1917434 GGGAGGTGCGCCCTTCACCCGGG - Intronic
1019622039 7:1997408-1997430 GGAAGGGGCTCCCTTGTCCCTGG - Intronic
1019695742 7:2445238-2445260 GGCAGGGCCACCCTTGTCCTGGG + Intergenic
1021051162 7:15987129-15987151 GGAAGATTCAACCTTATCCTTGG + Intergenic
1022654409 7:32305787-32305809 GGAAAGGGTACCCTTCTCCAAGG + Intergenic
1024152465 7:46586618-46586640 GGAATGTGCATCCCACTCCTGGG + Intergenic
1024475029 7:49800540-49800562 GGATGGTGCTCCCCTCCCCTGGG + Intronic
1030457157 7:109790522-109790544 GGCAGATGCACCCTTATTCTGGG - Intergenic
1033851741 7:145504760-145504782 GGAAGCTGAACCCGTCCCCTTGG - Intergenic
1034283941 7:149872441-149872463 GCCAAGTGCACCCTTATCCTAGG + Intergenic
1036296638 8:7543086-7543108 GGAAGCTGCACCCACCTCCAGGG - Intergenic
1036325928 8:7777933-7777955 GGAAGCTGCACCCACCTCCAGGG + Intergenic
1044630134 8:94270506-94270528 GGAAGGTCAATCCTTCTCCATGG - Intergenic
1045584086 8:103511820-103511842 GCAAGGAGCAGCCTTCTTCTAGG + Intronic
1047934386 8:129762489-129762511 GAAATGTGCATGCTTCTCCTTGG + Intronic
1051279856 9:15431342-15431364 AGAAGGAGCACCCTACCCCTAGG - Intronic
1057302727 9:93896068-93896090 GAGAGGTGCACCCATCCCCTCGG - Intergenic
1057599869 9:96448986-96449008 GGAAGGGGCCCTCTTCCCCTGGG + Intergenic
1060876727 9:127089255-127089277 GAAAGGTGGACCCGTCTCCATGG + Intronic
1061914357 9:133741660-133741682 GGAAGGACCACCCTTACCCTGGG - Intergenic
1062042489 9:134410573-134410595 GGCAGGTGCAGCCTTGTCCCTGG + Intronic
1191881790 X:65849734-65849756 GGAATGGGTACCCTTCTGCTGGG - Intergenic
1199984630 X:152941803-152941825 GGAAGGGGCAGCCAGCTCCTCGG - Intronic
1199997186 X:153032853-153032875 GGAAGGGGCAGCCAGCTCCTCGG - Intergenic
1200058175 X:153472382-153472404 GGAAGCTGCAGCCTGCTGCTGGG - Intronic
1200852532 Y:7899263-7899285 GGAAGGTGGGGCCTCCTCCTAGG + Intergenic
1201147479 Y:11072935-11072957 GGTAGGTCCACCCCTCCCCTGGG - Intergenic
1201417979 Y:13767000-13767022 GGATGAAGAACCCTTCTCCTGGG + Intergenic