ID: 1108058084

View in Genome Browser
Species Human (GRCh38)
Location 13:46505142-46505164
Sequence GGGAAGGTGCACCCTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108058084_1108058091 25 Left 1108058084 13:46505142-46505164 CCAGGAGAAGGGTGCACCTTCCC 0: 1
1: 0
2: 2
3: 18
4: 176
Right 1108058091 13:46505190-46505212 CACTACACCGGTATGCTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1108058084_1108058090 13 Left 1108058084 13:46505142-46505164 CCAGGAGAAGGGTGCACCTTCCC 0: 1
1: 0
2: 2
3: 18
4: 176
Right 1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG 0: 1
1: 0
2: 4
3: 2
4: 44
1108058084_1108058092 28 Left 1108058084 13:46505142-46505164 CCAGGAGAAGGGTGCACCTTCCC 0: 1
1: 0
2: 2
3: 18
4: 176
Right 1108058092 13:46505193-46505215 TACACCGGTATGCTTGAAGGTGG 0: 1
1: 0
2: 3
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108058084 Original CRISPR GGGAAGGTGCACCCTTCTCC TGG (reversed) Intergenic
900702150 1:4055117-4055139 GGGAAGGGACTCCCTGCTCCTGG - Intergenic
900725794 1:4215745-4215767 GGGAAGTTGGACACTTCTTCTGG - Intergenic
900735982 1:4299828-4299850 TGAAACTTGCACCCTTCTCCTGG + Intergenic
901603679 1:10442420-10442442 TGGAAAGTGCAGCCTTCTACAGG + Exonic
902282394 1:15384111-15384133 TGGAGGGGGCACCCTTCTCTGGG - Intronic
906146199 1:43562067-43562089 GGTAAGGTGCTCCCTCCTACTGG + Intronic
912514387 1:110209104-110209126 GGGAAGGTGCACAGGTGTCCAGG + Intergenic
915231990 1:154452490-154452512 GCTCAGATGCACCCTTCTCCGGG + Intronic
922127865 1:222746575-222746597 TGGAAGGTACACTCTTCTCTAGG - Exonic
922565356 1:226597985-226598007 GGGAAGCTGCTCCTTCCTCCTGG + Intronic
922916377 1:229260923-229260945 GGGAAGATGTAACCTACTCCAGG - Intergenic
923942759 1:238845686-238845708 GGGTAGGTGCACCCAGCTGCTGG - Intergenic
924451457 1:244182470-244182492 GCGACGGTGCACCTTTCCCCAGG + Intergenic
1062958510 10:1556135-1556157 GGGAAGGTGCCCCCTCATCCTGG - Intronic
1063663224 10:8047848-8047870 TGGCATGCGCACCCTTCTCCCGG - Intergenic
1066003629 10:31127684-31127706 AGGATGGAGCACCATTCTCCAGG - Intergenic
1067284209 10:44895551-44895573 CAGCAGGTGCATCCTTCTCCTGG - Intergenic
1067553090 10:47248713-47248735 GGGAAGGGTCACCCACCTCCAGG + Intergenic
1067777429 10:49173702-49173724 CGGAAGCTGGACTCTTCTCCTGG + Intronic
1069174960 10:65279474-65279496 GGAGAGGACCACCCTTCTCCAGG + Intergenic
1070772085 10:79088427-79088449 GGGGAGGGCCACCCTTCTGCTGG + Intronic
1074776491 10:116771428-116771450 GTGAAGGGTCACCCTCCTCCGGG + Intergenic
1075820591 10:125305204-125305226 GAGAAGGTGCAAACTTCACCTGG + Intergenic
1076521705 10:131085281-131085303 GGGCAGGTGCACAGTGCTCCAGG - Intergenic
1076566523 10:131403121-131403143 GGGAAGGTGTGCCCTGTTCCGGG - Intergenic
1076608875 10:131707978-131708000 GGGAAGGTGAATCCTTCCTCAGG + Intergenic
1077160288 11:1109584-1109606 GGGAAGGTGCTCTCATCCCCAGG + Intergenic
1077183164 11:1225336-1225358 GGGATGGTGCCTCCTTCTCAAGG - Intronic
1078637454 11:13065349-13065371 GGGAAGGAGCAGCCGTGTCCAGG - Intergenic
1080625554 11:34027702-34027724 GGGTCAGTGCACCATTCTCCTGG + Intergenic
1082005617 11:47417544-47417566 GGGAAGGGGCGCCCTGCGCCTGG - Intergenic
1083204516 11:61140226-61140248 GGTCAGATGCACCCTTCTCCAGG + Intronic
1083583986 11:63843278-63843300 TGGAAGCTGGACCTTTCTCCAGG - Intronic
1083765656 11:64840295-64840317 GGCCAGGTGCACCCTTCCCCCGG - Intronic
1084177239 11:67429245-67429267 GGGCGGGCGCACCCTCCTCCTGG + Intronic
1084334308 11:68447733-68447755 GGGAAGGTGCAGCCAACACCGGG - Intronic
1088293915 11:108271088-108271110 GGCAAGGGGTACTCTTCTCCAGG - Exonic
1088782477 11:113149208-113149230 GGGAATGTGCACCCTTGTCTTGG - Intronic
1091313718 11:134595941-134595963 GGGATGGTACAGCCTTCTCGGGG + Intergenic
1091319562 11:134640077-134640099 AGGGAGCCGCACCCTTCTCCAGG - Intergenic
1091688769 12:2581865-2581887 GGGAAGCTGCACCCTTTTACCGG + Intronic
1094475488 12:30837486-30837508 GTGAGGGTGCACCCTTCTGTAGG + Intergenic
1101078828 12:101160529-101160551 AGGCAGTTGCACCCTTCCCCTGG + Intronic
1102031539 12:109742783-109742805 GGGAGGCTGCAACCGTCTCCGGG + Intronic
1103381398 12:120496584-120496606 GGGAAGGAACCCCCTGCTCCCGG - Intronic
1103932286 12:124457233-124457255 GGGCAGGTGCCCGCTGCTCCGGG - Intronic
1103979314 12:124726310-124726332 GAGACGGTGCACCCAACTCCAGG - Intergenic
1108058084 13:46505142-46505164 GGGAAGGTGCACCCTTCTCCTGG - Intergenic
1114689443 14:24566606-24566628 GGGAAGGTGGAACCTTTTACAGG - Intergenic
1115653347 14:35419740-35419762 CTGAAGGTGCATCCTTCTCCGGG - Intergenic
1117338322 14:54773639-54773661 GGGCAGGTCCATGCTTCTCCTGG - Intronic
1117836413 14:59811116-59811138 GAGGAGGTTCACCCTTCCCCTGG - Intronic
1119637910 14:76291766-76291788 CTGAAGGTGCCCCCTTCTCTTGG - Intergenic
1120061596 14:79989780-79989802 GGGAAGCTTCACCTTTCTGCTGG - Intergenic
1122406835 14:101505767-101505789 GGGAAGCTGGAACCCTCTCCTGG - Intergenic
1124692758 15:31839171-31839193 GGAAAGGGGCACCCTCGTCCTGG + Intronic
1128683228 15:69666347-69666369 GGGAGGGTCCACCATTCACCCGG + Intergenic
1129195708 15:73965004-73965026 GGGATGTTGCTCCATTCTCCTGG + Intergenic
1132718782 16:1305886-1305908 GTGAAGGTGGACCCTTACCCCGG - Intergenic
1132915012 16:2339581-2339603 GGAGAGGTTCACTCTTCTCCTGG - Intronic
1135783891 16:25330602-25330624 GGGAAGTAGAACCCTTATCCAGG - Intergenic
1138474924 16:57265001-57265023 GGGAAGGTGTCCCGCTCTCCAGG + Intronic
1138601920 16:58060649-58060671 TGGCAGGTGCACCCTCCTCGGGG - Intergenic
1139660432 16:68417017-68417039 GGGCTGGTGCACCCATCCCCTGG + Intronic
1140113266 16:72021314-72021336 GGGCAGCTGCACCCCTCTCCAGG + Intronic
1141665816 16:85464627-85464649 GGGAATGTGCCACCATCTCCCGG + Intergenic
1142198904 16:88751807-88751829 GGGGAGGTGCCACCTTCTCTGGG - Intronic
1143011663 17:3869452-3869474 GGGTAGATGCTCCCTTGTCCTGG - Intronic
1143164837 17:4892603-4892625 GGCACGGTGCTCCCTTCTCTGGG - Intronic
1146484283 17:33230720-33230742 GAGAAGATGCAACTTTCTCCAGG + Intronic
1146689138 17:34861116-34861138 GGGAAAGTGCCCCCTCCACCAGG + Intergenic
1146901503 17:36592201-36592223 GGGCAGGTGAACCCGACTCCGGG - Intronic
1148465965 17:47865496-47865518 GGGGAGGTGGAGCCTTCCCCAGG - Intergenic
1150561819 17:66301970-66301992 GGGAAGGGGCTCCCTGCTGCGGG + Intergenic
1152237172 17:79144623-79144645 AGGAAGAAGCACCCCTCTCCCGG + Intronic
1152357107 17:79812754-79812776 GGGCCCGAGCACCCTTCTCCGGG - Intergenic
1153575053 18:6511795-6511817 GGGAAGGAGAACCATTCTCAGGG + Intronic
1156491457 18:37498760-37498782 GGCCAGGTGCAACCCTCTCCCGG - Intronic
1158973815 18:62692541-62692563 GGAAAGGGGCACCTTCCTCCAGG + Intergenic
1161612095 19:5248798-5248820 GGGAAGGTCCCCCATCCTCCTGG + Intronic
1163454748 19:17399916-17399938 GTGAAGGCCCACCCTGCTCCCGG + Intergenic
1164612804 19:29644407-29644429 GGGAAGGTGCCCTCAGCTCCGGG + Intergenic
1164735299 19:30536691-30536713 GGGAAAGTGGCCCCTTCCCCAGG + Intronic
1165291192 19:34887656-34887678 GAAAAGGTGCACCCAGCTCCTGG + Intergenic
1166557846 19:43713386-43713408 GGTCAGGTGCCCCCTCCTCCAGG + Intergenic
1167074965 19:47243101-47243123 GGGAAGGTGCGCGTGTCTCCAGG + Intergenic
1168130131 19:54312496-54312518 GGGAAGGGGCACCCTAGTCTGGG - Intronic
1168614474 19:57826729-57826751 GGGAAGGTGCACTCCTCTCCTGG + Intronic
925864639 2:8216274-8216296 GAGCAGGTGCACCCTTCTACTGG + Intergenic
927992467 2:27457824-27457846 GGCAAGGTGAGCCCTTCTCCTGG - Exonic
928312509 2:30222558-30222580 GGGAAGGTCCCCCCTACCCCTGG + Intergenic
929776781 2:44935122-44935144 GGGAAGAGGCGCCCTTCCCCTGG - Intergenic
929863157 2:45696438-45696460 GTGGAAGTGCACCCATCTCCTGG + Intronic
932287945 2:70552999-70553021 GGGAAGTTAAACCCCTCTCCCGG - Intronic
933776042 2:85771876-85771898 GGCAAGTTACGCCCTTCTCCTGG - Intronic
934950522 2:98572366-98572388 AGGAAAGTGCAGCCTCCTCCAGG - Intronic
934971669 2:98769274-98769296 GGAAGGATGAACCCTTCTCCCGG - Intergenic
935145153 2:100390494-100390516 GGATAGGTGCAGCCTTGTCCTGG + Intergenic
936117820 2:109716029-109716051 GGAAAGGTGTACCTTTCTCCTGG - Intergenic
937255472 2:120552365-120552387 GGGGAGGGGGACCTTTCTCCTGG + Intergenic
937287075 2:120760436-120760458 GGCAGGGTGGACCCTTCCCCAGG + Intronic
938299584 2:130200668-130200690 GGGAAGGCACACCCCTGTCCCGG + Intergenic
938457127 2:131473818-131473840 GGGAAGGCACACCCCTGTCCCGG - Intronic
940278265 2:151962193-151962215 GGAAAGCTGCATCCTTCTCAAGG + Intronic
943753913 2:191538484-191538506 GGGAAGGGGATCCCTCCTCCAGG - Intergenic
944307231 2:198192691-198192713 GTGAAGGTGCCTCCTTCACCTGG + Intronic
944417010 2:199488992-199489014 GGGACGGAGCTCCCTTCCCCAGG - Intergenic
948801142 2:240434250-240434272 GTGAAGGAGCAACCTTCTCTGGG + Intergenic
948865979 2:240775051-240775073 GGGAAGGAGCCGCCTGCTCCAGG - Intronic
948907533 2:240986900-240986922 GGGAAGGGCCACCCTGCTCTGGG - Intronic
1169374858 20:5058302-5058324 GGATAGGTACACCCTCCTCCAGG + Intergenic
1171369402 20:24651799-24651821 GGGAAGCTGCAAGTTTCTCCTGG - Intronic
1173570079 20:44070297-44070319 GGGAAACTGCACCCCACTCCTGG - Intergenic
1174686790 20:52464420-52464442 GGGTAGGTGTACCCTTCATCAGG + Intergenic
1175299414 20:57932386-57932408 TGGGAGATGCCCCCTTCTCCTGG - Intergenic
1175753581 20:61515446-61515468 GGGAAGGGGGACCCTCCTCATGG + Intronic
1176078919 20:63261990-63262012 GAGAGGGTGCTCCCTTCCCCTGG + Intronic
1176151655 20:63594505-63594527 GGGAGGCCTCACCCTTCTCCTGG - Intronic
1178670013 21:34582040-34582062 GGGAAGATGCAAGTTTCTCCCGG + Intronic
1179673198 21:42964177-42964199 GGGATGGTGGGCCCCTCTCCAGG - Intergenic
1182097645 22:27636866-27636888 GGGAAGGTCCAAAATTCTCCAGG + Intergenic
1183785076 22:40024502-40024524 GGGAAAGTGTCCCCTTCCCCTGG + Intronic
1184257869 22:43297247-43297269 GGTAGGCTGCACACTTCTCCTGG + Intronic
950443574 3:13023458-13023480 GGGCAGGTGCACCCAGCACCTGG + Intronic
953103171 3:39850119-39850141 GGGAAGCTGCAAACCTCTCCAGG + Intronic
954394717 3:50287436-50287458 GGGAAGGGGCACCAGCCTCCTGG + Exonic
954881085 3:53836389-53836411 GGGAAGGTGGACCATGCACCTGG - Intronic
955380359 3:58433575-58433597 GGGAGGGTCCCCCCTTCTCTCGG - Intronic
956732068 3:72205408-72205430 GAGCATGTGCACCCTTCTCTAGG - Intergenic
961664801 3:128488562-128488584 GGGAGGGGGCACCCCTCCCCGGG + Intronic
962387766 3:134946494-134946516 CAGAAGGTGCATACTTCTCCTGG + Intronic
964835299 3:160931354-160931376 GGGAAGCTGCACCCATCACCTGG + Intronic
966160403 3:176961609-176961631 GGCAACATGCACCCTTCTACTGG + Intergenic
968494304 4:906961-906983 CTAAACGTGCACCCTTCTCCTGG + Intronic
968572172 4:1347498-1347520 GGGAAGCTGCGCCCTACTCGGGG - Exonic
969045616 4:4334418-4334440 GGGAAGGTGCCACCTTCTTGGGG - Intergenic
969189662 4:5506869-5506891 GGGAAGGGGAGCCCATCTCCTGG - Intergenic
969511480 4:7620481-7620503 GGGAAGTTGCACCCTCCCCCAGG - Intronic
970826633 4:20284158-20284180 GGAAAGGGGCCCCATTCTCCAGG - Intronic
979290244 4:118971869-118971891 GGGAATGTCCACCCCTCTCATGG - Intronic
980107193 4:128599351-128599373 GGGGAGGTGCCCCCTTCCCCTGG + Intergenic
981781857 4:148439888-148439910 GGTAAGGTGCTACCTTGTCCAGG - Intronic
983062700 4:163176504-163176526 TGGAAAGTGCACCTCTCTCCAGG + Intergenic
986130672 5:4926981-4927003 GGCAAGGTCTATCCTTCTCCAGG - Intergenic
987064700 5:14277906-14277928 TGGAAGGTGCACCCTTAGCAGGG + Intronic
987816098 5:22902178-22902200 GGACAGGTGCCCCCTGCTCCTGG - Intergenic
989388588 5:40877572-40877594 GTGAGGGTGCACCCTTCTATAGG - Intergenic
998506157 5:142674418-142674440 GGAAAGGTGTCCCCCTCTCCAGG - Intronic
1002134528 5:177099562-177099584 GGACAGGTGCACCCTACTCATGG - Intergenic
1003037973 6:2661746-2661768 AGGAAGCTGCACCCTTGTCGGGG + Intergenic
1006413313 6:33888357-33888379 TGGAAGTTGCACCTTTCTCGGGG - Intergenic
1006822773 6:36911603-36911625 AGGAAGGTGCCCCTTTCTCCTGG + Intronic
1008084195 6:47226814-47226836 GGGAAGGTGGCCACTTCTCCTGG + Intergenic
1009396994 6:63211584-63211606 GGGAAGGTGCGCCAGTCTCCTGG - Exonic
1010011997 6:71058679-71058701 TGGAAGGTGCCCCCTTTCCCTGG + Intergenic
1010204467 6:73310101-73310123 GGGATGCTGCTCCGTTCTCCGGG - Exonic
1013235608 6:108195455-108195477 GGGAAGGTCAGCCCTTGTCCTGG - Intergenic
1016544374 6:145203920-145203942 GGGAAGCTGCACTGTTTTCCCGG + Intergenic
1018787401 6:167118931-167118953 GGGCAGGTGCACCCTCCTCCTGG - Intergenic
1019607485 7:1917413-1917435 GGGGAGGTGCGCCCTTCACCCGG - Intronic
1019695741 7:2445237-2445259 GGGCAGGGCCACCCTTGTCCTGG + Intergenic
1019713129 7:2526404-2526426 GAGCAGGTGCACCATCCTCCGGG + Exonic
1019874143 7:3793902-3793924 GGCAGGGAGCACCCTGCTCCCGG - Intronic
1023218572 7:37893848-37893870 GGAGAGGTCCAGCCTTCTCCAGG + Intronic
1023382592 7:39623593-39623615 GGGGAGATCCACCCTCCTCCTGG - Exonic
1024475028 7:49800539-49800561 GGGATGGTGCTCCCCTCCCCTGG + Intronic
1026730845 7:72910672-72910694 GGGAAGGTGCAGCTTTTTTCAGG + Intronic
1027113244 7:75457497-75457519 GGGAAGGTGCAGCTTTTTTCAGG - Intronic
1027285494 7:76642092-76642114 GGGAAGGTGCAGCTTTTTTCAGG - Intergenic
1027470134 7:78563361-78563383 GGGAAGGTGCATGCTGCCCCAGG - Intronic
1028584467 7:92439292-92439314 TTGACTGTGCACCCTTCTCCTGG - Intergenic
1034528042 7:151678490-151678512 GAGAAGGAGCCCCCTTTTCCAGG + Intronic
1035076038 7:156178319-156178341 GGGAAGGAGCAGGCCTCTCCGGG + Intergenic
1036296639 8:7543087-7543109 AGGAAGCTGCACCCACCTCCAGG - Intergenic
1036325927 8:7777932-7777954 AGGAAGCTGCACCCACCTCCAGG + Intergenic
1036562067 8:9906302-9906324 GGGCAGGCGCCCCCTTTTCCCGG - Intergenic
1038665346 8:29532568-29532590 GAGAATGTTCACCATTCTCCAGG - Intergenic
1038700176 8:29842617-29842639 GGGGAGGATCACCCTTCTCAGGG - Intergenic
1040582675 8:48709780-48709802 CGGAAGGTGCACCCACTTCCTGG + Intergenic
1040836526 8:51737488-51737510 AGGAATGAGCACCCTGCTCCAGG + Intronic
1042769494 8:72364486-72364508 TGGATGGTGCACTGTTCTCCTGG + Intergenic
1046915284 8:119672735-119672757 GGGAAGGGGCTCCCTCCTTCAGG + Intronic
1047203537 8:122785535-122785557 GGGAAGGGGCACCCCTCTCAGGG + Intronic
1048500155 8:134968177-134968199 GGGAAGGAAGGCCCTTCTCCAGG - Intergenic
1049257898 8:141623660-141623682 GGGAAGGTGCTCACTCCCCCGGG - Intergenic
1053181972 9:35980394-35980416 GGGAAGCTGCCCTCATCTCCTGG + Intergenic
1055565013 9:77559505-77559527 GGTAAGCTGTGCCCTTCTCCTGG - Intronic
1056367770 9:85922883-85922905 GGGAAGATCCACATTTCTCCTGG - Intergenic
1057407960 9:94790515-94790537 TGGAAGCTGCACCCTGCTTCTGG - Intronic
1059919728 9:119145667-119145689 GGCAAGGTGTACCCTGCTCTAGG - Intergenic
1061916951 9:133760254-133760276 GTGAAAATGCCCCCTTCTCCAGG - Intergenic
1189497713 X:41524535-41524557 GGCAAGGTTCCCCCTTCCCCAGG - Intronic
1194152698 X:90344948-90344970 GGGGAGATGCACCCATCTGCAGG + Intergenic
1198993475 X:142544835-142544857 TCACAGGTGCACCCTTCTCCAGG + Intergenic
1200058176 X:153472383-153472405 GGGAAGCTGCAGCCTGCTGCTGG - Intronic
1200499044 Y:3921693-3921715 GGGGAGATGCACCCATCTGCAGG + Intergenic
1201147480 Y:11072936-11072958 GGGTAGGTCCACCCCTCCCCTGG - Intergenic