ID: 1108058086

View in Genome Browser
Species Human (GRCh38)
Location 13:46505158-46505180
Sequence GCTCTGGCCATGCATCGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108058086_1108058091 9 Left 1108058086 13:46505158-46505180 CCTTCCCGATGCATGGCCAGAGC 0: 1
1: 0
2: 1
3: 10
4: 88
Right 1108058091 13:46505190-46505212 CACTACACCGGTATGCTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1108058086_1108058092 12 Left 1108058086 13:46505158-46505180 CCTTCCCGATGCATGGCCAGAGC 0: 1
1: 0
2: 1
3: 10
4: 88
Right 1108058092 13:46505193-46505215 TACACCGGTATGCTTGAAGGTGG 0: 1
1: 0
2: 3
3: 2
4: 39
1108058086_1108058090 -3 Left 1108058086 13:46505158-46505180 CCTTCCCGATGCATGGCCAGAGC 0: 1
1: 0
2: 1
3: 10
4: 88
Right 1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG 0: 1
1: 0
2: 4
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108058086 Original CRISPR GCTCTGGCCATGCATCGGGA AGG (reversed) Intergenic
900386383 1:2412796-2412818 GCGCTGGCGAGGCAGCGGGATGG + Intronic
903595747 1:24493008-24493030 GCTCTGAGCATGCTTCGGGTAGG + Intergenic
904768460 1:32868257-32868279 GCTCTGGCCCTGAATGGAGATGG + Exonic
905093590 1:35449773-35449795 GCTCTGTCCATGCTCGGGGAAGG + Intronic
906515656 1:46437439-46437461 GCCCTGGCCATGCTAGGGGATGG - Intergenic
913690989 1:121279649-121279671 GCTGTGGCCAAGCATGGGCAAGG + Intronic
914146550 1:145000314-145000336 GCTGTGGCCAAGCATGGGCAAGG - Intronic
919895837 1:202009371-202009393 GCTCTGGCCATGGAGCTGGATGG + Exonic
920478312 1:206298124-206298146 GCTGTGGCCAAGCATGGGCAAGG + Intronic
1065483287 10:26215189-26215211 GCTCTGGCCAGGCGCGGGGAAGG + Intergenic
1065705641 10:28469409-28469431 ACTCTGGCCATGAATCTGGGAGG + Intergenic
1069280798 10:66651532-66651554 GCTCGGGCCTTGCGTGGGGAGGG + Intronic
1069750381 10:70741556-70741578 ACACTGGTCATGCAACGGGAAGG - Intronic
1071374727 10:84990903-84990925 GCTCTGGCCACTCAGTGGGAAGG + Intergenic
1073494183 10:103876521-103876543 GGTGTGGCCAGGCATGGGGAGGG - Intergenic
1075863703 10:125698947-125698969 GCCCAGGCCATGCATCCGCAGGG - Intergenic
1078605767 11:12774156-12774178 GCTCTGGTCATGCATGGGAGAGG + Intronic
1081024817 11:37998238-37998260 GCTCTGGCCATGTAAAGGGATGG - Intergenic
1081662487 11:44896575-44896597 GCTGTGGCCATGTCTCAGGAGGG + Intronic
1084870820 11:72097602-72097624 GCTCTGGCCAGGGATGGGGTGGG - Exonic
1087483730 11:98734470-98734492 TCTCTGGCCAGGCAGTGGGAGGG - Intergenic
1091215675 11:133899945-133899967 GCTCTGTCCATGCAGCTGGAAGG - Intergenic
1095987039 12:48005462-48005484 GCCCTGGCCAGGGATCGGGGAGG + Intergenic
1097375198 12:58835176-58835198 GCTCTGGCCATGTAAAGGGCTGG - Intergenic
1106412006 13:29517075-29517097 GGGCTGGCCAGGCATCAGGAGGG + Intronic
1106860705 13:33904579-33904601 GATCTGGCCTTGCTTCGGGAGGG - Intronic
1108058086 13:46505158-46505180 GCTCTGGCCATGCATCGGGAAGG - Intergenic
1114844643 14:26306651-26306673 GCTCTGGCAATGTATTGGTAAGG + Intergenic
1114887844 14:26876989-26877011 TCTCTAGCCAAGCATCAGGAAGG + Intergenic
1119615493 14:76096196-76096218 GCTCTGGCCAGGCAGAGGAAAGG - Intergenic
1122796124 14:104207103-104207125 GCTCTGGGCATGGATGGGGATGG + Intergenic
1128356026 15:66927226-66927248 GCTCTGGCCATGCATTGAGAGGG - Intergenic
1128832788 15:70785038-70785060 TCTCTGTCTCTGCATCGGGATGG + Intergenic
1132839825 16:1973603-1973625 GCTCTGGGCAAGCCTGGGGATGG + Intronic
1135742236 16:24985707-24985729 GATCTGGACATGTTTCGGGAGGG + Intronic
1139023416 16:62781799-62781821 GAGCTGGCCATGGATGGGGAAGG + Intergenic
1139924608 16:70479288-70479310 GCTCTGGCCATGCACGTGGGGGG - Exonic
1143149415 17:4798285-4798307 GCTTTGGCCATGGAGCGGGATGG + Exonic
1145783772 17:27581090-27581112 GTTCTGGAGAGGCATCGGGAAGG + Intronic
1147537846 17:41332574-41332596 ACCCTGGCCATGCATCTAGAAGG + Intergenic
1147947371 17:44087572-44087594 GCCCTGACCATGCCCCGGGAGGG - Exonic
1151583207 17:74991934-74991956 GCTCTGACCTGGCAACGGGAGGG + Intronic
1151954749 17:77374658-77374680 GTTCTGGCCATGGAGCGGGGAGG - Intronic
1156183263 18:34630742-34630764 GCTCTGTTCATGCAGCTGGAAGG + Intronic
1160865854 19:1255647-1255669 GCTCTGGCCCTGCAGCAGGGAGG - Exonic
1161382577 19:3973696-3973718 GCTCTGGCCCTGCATTGTCAAGG - Intergenic
1161382736 19:3974768-3974790 GCTCTGGCCCTGCATTGTCAAGG - Intergenic
1162436084 19:10660010-10660032 GCTCTGGGAATACATGGGGAAGG + Intronic
1163860652 19:19741031-19741053 GTCCTGGCCCTGCATCCGGAGGG - Intergenic
1165898466 19:39156853-39156875 GAGCTGGCCAGGCCTCGGGAGGG + Intronic
1166121113 19:40687265-40687287 GCCCTGCACATGCATCTGGAGGG - Intronic
1168614471 19:57826713-57826735 GGTCTGGCCGTGCCTCGGGAAGG + Intronic
925390379 2:3490286-3490308 GCTCTGGCCCTGCATCTGCCTGG - Intergenic
929095650 2:38261215-38261237 GCTCTGGGCATGCCTTGGGCTGG - Intergenic
932706205 2:74026847-74026869 GCTCTGGAAATGCATGGGCAGGG - Intronic
934461751 2:94216687-94216709 GCTCTGGCCATGCGTCGCACAGG + Intergenic
935319385 2:101871098-101871120 GCTATGGCAATGCATTCGGATGG + Intronic
938251918 2:129822001-129822023 GCTCTGGCCATGACCCTGGAAGG - Intergenic
942173235 2:173307677-173307699 GCTCTGTCCAGGCAGCAGGAAGG + Intergenic
946189683 2:218001829-218001851 GTTCTGGCCAGTCCTCGGGAGGG - Intronic
1170825583 20:19792050-19792072 GCTCTGGCCATGTCCCTGGAAGG - Intergenic
1171317924 20:24211689-24211711 GCTCTAGCCATGCACCTGGCTGG - Intergenic
1175037268 20:56011676-56011698 GCTCTGCCCATGAACTGGGAAGG + Intergenic
1175242401 20:57559438-57559460 ATTGTGGTCATGCATCGGGATGG + Intergenic
1175734577 20:61376403-61376425 GCTCTGGCCAGGCCTGGGAAGGG + Intronic
1182035997 22:27198792-27198814 GCTCTACCCATGCATGGGCAAGG - Intergenic
1184860440 22:47170662-47170684 TCTCTGGTCCTGCATCAGGAGGG - Intronic
950865294 3:16183768-16183790 ACTCTGGCCAGGCAAGGGGAGGG + Intronic
952029103 3:29119818-29119840 GCTCAGGCCATGGCTTGGGAGGG + Intergenic
952884292 3:38003127-38003149 GCTCAGGCCCTGCATGAGGAGGG - Intronic
953909074 3:46882824-46882846 GCTCTGGCCAAGGATGGGGAAGG + Intronic
960597105 3:119416158-119416180 TCTCTGGCCATTCTTAGGGATGG - Exonic
963418341 3:145027558-145027580 GCTCTGGCCATGGATTCAGAGGG + Intergenic
968453516 4:686195-686217 GCTCTGGCCACCCATGAGGAAGG + Exonic
968654285 4:1771896-1771918 GCTCGGGGCAGGCATGGGGAGGG + Intergenic
969503874 4:7571458-7571480 GCTCTGGCCATGCCCCGTGTGGG + Intronic
980430930 4:132693851-132693873 GCTCTGCCCATGCTTCAGAAAGG + Intergenic
985927016 5:3026753-3026775 GCCCTGGCCATGCATAGAGTGGG - Intergenic
992384262 5:76268461-76268483 GCTGCAGCCATGCAGCGGGACGG - Intronic
1002321827 5:178380978-178381000 GCACTGGCCACGGATCGGAATGG - Intronic
1006259956 6:32859410-32859432 GCTCTGGCCATGAGCCGGGATGG + Exonic
1012097186 6:94977425-94977447 GCTCTGGCCATGGATTCAGAGGG - Intergenic
1013842973 6:114420093-114420115 GCTTTGGACCTGCATCTGGAGGG - Intergenic
1017931747 6:158961525-158961547 ACTCTGACCATGCCACGGGAAGG + Intergenic
1019758011 7:2787694-2787716 ACACTGGCCAGGCATCGGGAAGG + Intronic
1021562458 7:21981965-21981987 GCTCTTGCCATGTTTAGGGAAGG - Intergenic
1032950669 7:136907369-136907391 TCTCTGGCCATGAACTGGGATGG + Intronic
1034266958 7:149785695-149785717 GCGCTGGCCGTGCGTCTGGAGGG + Intergenic
1038157171 8:25001193-25001215 GCACTGGCCTTACATGGGGATGG - Intergenic
1051562103 9:18453328-18453350 GCTCTGGACCTGCAATGGGAGGG + Intergenic
1052230278 9:26142446-26142468 GCGCTGGCCATGAAGTGGGAAGG - Intergenic
1055380345 9:75699827-75699849 GCTTTGGCAATTCATTGGGAAGG + Intergenic
1059223075 9:112644225-112644247 GCTCAGGCAGTGCATGGGGAAGG + Intronic
1059752904 9:117265428-117265450 CCTCTGCCCATGCCTGGGGAAGG - Intronic
1060144177 9:121236724-121236746 GCTCAGGGCTTGCATCAGGAAGG + Intronic
1060992323 9:127856231-127856253 AGTCTGGCCCTGCATTGGGAGGG + Intergenic
1061385188 9:130285450-130285472 GCTCTGGCCATGCATGGCAGAGG - Intronic
1188117061 X:26257429-26257451 GATCTGGCCATGCACATGGATGG - Intergenic
1190790573 X:53696258-53696280 AATCTGACCATCCATCGGGAGGG - Intergenic
1199744513 X:150763433-150763455 GCTCAGCCCATTCATGGGGATGG + Intronic