ID: 1108058087

View in Genome Browser
Species Human (GRCh38)
Location 13:46505162-46505184
Sequence CGCAGCTCTGGCCATGCATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108058087_1108058090 -7 Left 1108058087 13:46505162-46505184 CCCGATGCATGGCCAGAGCTGCG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG 0: 1
1: 0
2: 4
3: 2
4: 44
1108058087_1108058091 5 Left 1108058087 13:46505162-46505184 CCCGATGCATGGCCAGAGCTGCG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1108058091 13:46505190-46505212 CACTACACCGGTATGCTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1108058087_1108058092 8 Left 1108058087 13:46505162-46505184 CCCGATGCATGGCCAGAGCTGCG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1108058092 13:46505193-46505215 TACACCGGTATGCTTGAAGGTGG 0: 1
1: 0
2: 3
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108058087 Original CRISPR CGCAGCTCTGGCCATGCATC GGG (reversed) Intergenic
900633962 1:3652694-3652716 CGCAGCGCTGGGCAGGCACCTGG + Intronic
900955332 1:5883218-5883240 CGCAGCTCTGGCCCTGGCACAGG - Intronic
901438357 1:9263064-9263086 CGCACCTCTGACCCTGCGTCGGG + Intronic
902326602 1:15704892-15704914 CTCAGCCCGGGCCAGGCATCAGG + Intronic
903178213 1:21592976-21592998 AGCAGCTCTGGGCAGGGATCCGG - Intergenic
903332104 1:22601549-22601571 CGCAGCCAGGGCCATGGATCTGG - Intronic
903810436 1:26032216-26032238 CGCTGCTCTGTCCTTGCCTCTGG - Intronic
905342325 1:37287789-37287811 CCCAGCCATGGCCATGCATATGG - Intergenic
905850773 1:41273035-41273057 GGCAGCTCAGGCCCTGCTTCTGG - Intergenic
916889678 1:169103899-169103921 CTTAGCTCTTGCCATGCCTCAGG + Intergenic
923349969 1:233094768-233094790 CTCAACTCTGGCAATCCATCAGG - Intronic
923391119 1:233515250-233515272 CGGAGCTGGGGCCATGCTTCAGG + Intergenic
1066516919 10:36172746-36172768 CTCAGCGCCGGCCATGAATCAGG + Intergenic
1067219556 10:44334182-44334204 CCCAGCCCTGCCCCTGCATCTGG + Intergenic
1067284279 10:44895997-44896019 GCCAGCTCTGGACCTGCATCTGG - Intergenic
1070190998 10:74112067-74112089 CGCGGCTCAGTCCTTGCATCGGG + Exonic
1070416854 10:76198474-76198496 CTCAGCCCTGGCCATGTGTCAGG + Intronic
1076562810 10:131377986-131378008 GGCAGCTGTGGCCATGCAGGTGG - Intergenic
1076586458 10:131551713-131551735 CGCAGCTCTGGAGAAACATCTGG + Intergenic
1076866082 10:133167089-133167111 AGCAGCTCTGGCCGAGCCTCCGG + Intronic
1077204468 11:1336002-1336024 AGCAGCTCTTGCAAAGCATCGGG + Intergenic
1078440404 11:11360315-11360337 TGCTGCTCTCGCAATGCATCAGG + Intronic
1082711787 11:56561429-56561451 CACAGCTTGTGCCATGCATCTGG + Intergenic
1083924517 11:65797897-65797919 CGCACCTCTGTCCAGGCACCTGG + Intergenic
1084236139 11:67788924-67788946 TGCAGCTCTAGAGATGCATCAGG - Intergenic
1085101082 11:73800604-73800626 AGCAGCTCTGGCCCTGCAAGTGG - Intronic
1085761846 11:79248025-79248047 CGCAGGGCTGGCCATCCATCTGG + Intronic
1089581379 11:119483695-119483717 CTCAGCTCTGCCCATGTTTCTGG + Intergenic
1098576959 12:72053565-72053587 CTCAACTTTGGCCATGCATGTGG + Intronic
1101437070 12:104672870-104672892 GGCAGGTATGGCCAAGCATCAGG - Intronic
1101541740 12:105671642-105671664 CGCAGCTCTGGGATTACATCTGG + Intergenic
1102714627 12:114959613-114959635 CACATCTCTGTCCATTCATCAGG - Intergenic
1103403062 12:120656179-120656201 CGCAGTTCTGGGCCAGCATCAGG - Intronic
1104722818 12:131054880-131054902 CACAGCACTGGACATCCATCAGG - Intronic
1104962921 12:132496759-132496781 CGCATCTCTGGTCCAGCATCAGG + Intronic
1106055040 13:26229507-26229529 CTCAGATCTGGCCCTGCATGAGG + Intergenic
1106412004 13:29517071-29517093 CGCAGGGCTGGCCAGGCATCAGG + Intronic
1107349117 13:39495823-39495845 CCCAACCCTGGCCATGCAGCAGG - Intronic
1108058087 13:46505162-46505184 CGCAGCTCTGGCCATGCATCGGG - Intergenic
1114175736 14:20317964-20317986 CGCAGCTCCGGCTAAGAATCGGG + Exonic
1119332444 14:73804929-73804951 CACAGTTCTGGCCATGCTCCTGG + Intergenic
1122006599 14:98709905-98709927 CTCAGCTCTGCCCTTGTATCAGG + Intergenic
1122814565 14:104306177-104306199 GGTGGCTCTGCCCATGCATCGGG - Intergenic
1126110706 15:45173204-45173226 AGCAGATCTGACCTTGCATCTGG - Intronic
1128353493 15:66907935-66907957 GGGAGCTTTGGCCATGCAGCTGG + Intergenic
1129355410 15:74987583-74987605 CCCAGCACTGGCCAAGCCTCTGG - Intronic
1130518684 15:84645689-84645711 CGCAGCCCTGGCCCTGGGTCTGG - Exonic
1136100501 16:27991993-27992015 CGTCGCTCTTGCCATGCAACAGG - Intronic
1136652268 16:31683078-31683100 CCCAGCCCTGGCAGTGCATCAGG + Intergenic
1139371288 16:66471022-66471044 CTCAGGTCTGGCCATGGCTCTGG - Intronic
1142696157 17:1635008-1635030 GGCAGCCCTGGCCTTGCCTCTGG - Exonic
1146675202 17:34768539-34768561 TCCAGCTCTGGCCATGCCTTTGG + Intergenic
1147960072 17:44161967-44161989 GGCAGCTCTGGGCATGTGTCTGG + Exonic
1148064598 17:44859841-44859863 TGCAGCTCTGCCCATTCAGCTGG + Intronic
1148685109 17:49496540-49496562 CGCAGCTCTGGCTACGCAGGCGG + Intronic
1151170870 17:72245187-72245209 CTCAGCTCTGGCATTGCATCAGG - Intergenic
1151772867 17:76176809-76176831 CGGAGCTGGGGCCATGCTTCAGG + Intronic
1153588710 18:6650919-6650941 CACTGCTCTGCTCATGCATCGGG + Intergenic
1155352383 18:24919311-24919333 ATCATCTCTGGCCATGGATCTGG + Intergenic
1158390103 18:57038036-57038058 CTCAGCTTTGGCCCTGCAGCAGG + Intergenic
1163529776 19:17842555-17842577 CGAAGCTCAGGCCCTGGATCAGG + Exonic
1164500454 19:28815155-28815177 GGCAGCTCTGCCCCTGCAGCAGG + Intergenic
1166831680 19:45643262-45643284 CGAAGCTCTGTCCTTGCAGCTGG - Intronic
1168614470 19:57826709-57826731 CGCAGGTCTGGCCGTGCCTCGGG + Intronic
925329126 2:3044735-3044757 AGACGCTCTGGCCAAGCATCAGG - Intergenic
925358782 2:3262755-3262777 AACAGCTCTGACCATGCCTCTGG + Intronic
926433797 2:12817709-12817731 CCCAGCACTGGCCTTGCCTCAGG - Intergenic
928767087 2:34660197-34660219 CTCACCTCTGGCCATGCGGCTGG + Intergenic
937725896 2:125166214-125166236 CTCAGCTCTGGCCCTGCACCTGG - Intergenic
938243685 2:129761694-129761716 CACAGCTGTGGCCAAGCAGCAGG + Intergenic
946929076 2:224655184-224655206 ATCCGCTCTGGCCATGCTTCAGG + Intergenic
948291378 2:236827322-236827344 AGAAGCTCTGGCCAGGAATCAGG + Intergenic
948949201 2:241238148-241238170 CCCAGCTCTGCTCATGCACCTGG - Intronic
949027158 2:241771753-241771775 GGCAGCTCTGGCCCTGCCTGGGG - Intergenic
1169741214 20:8896789-8896811 CCCAGACCTGGCCCTGCATCTGG + Intronic
1170948939 20:20916810-20916832 CCCAGCCCTGGGCATGCATGTGG - Intergenic
1173103207 20:40106955-40106977 CACAGATCTGGACTTGCATCCGG + Intergenic
1175387133 20:58604632-58604654 CCCAGCTCTGCCCATCCATCTGG + Intergenic
1182719629 22:32386796-32386818 GGCAGACCTGGCCATGCAGCAGG - Intergenic
1184598389 22:45527882-45527904 CGCAGCTCTGGCCCTGGGCCTGG - Exonic
1185346888 22:50314308-50314330 CGCAGCTCTGGCCATCCCCACGG + Intronic
949877400 3:8635213-8635235 CTCAGCCCTGGCAGTGCATCAGG - Intronic
957697089 3:83653029-83653051 CACAGCTTTGGCCATGCACATGG + Intergenic
961786140 3:129347968-129347990 CAGAGCCCTGGCCATGCATGAGG - Intergenic
963041163 3:141071101-141071123 CCCAGCAGTGGCCATGGATCAGG + Intronic
963778501 3:149464045-149464067 CGCAGGTCTGGCCGCGCTTCAGG + Intergenic
966313348 3:178618464-178618486 CGAAGCTCTTGCTATGTATCTGG - Intronic
968518931 4:1027110-1027132 CGCAGGCCTGGCCAGGCATGTGG - Intergenic
969176001 4:5399549-5399571 CTCAGCTCTGTCCATGCCCCAGG - Intronic
969244757 4:5925035-5925057 CGCAGTGGTGGCCATGCACCAGG + Intronic
969463443 4:7340964-7340986 AGCTGCTCTGGCCATGCAGCAGG - Intronic
969505949 4:7587812-7587834 CACAGTCCTGGCCATGCCTCTGG + Intronic
971454127 4:26828054-26828076 CCCAGCTCTGGCCCTGACTCTGG + Intergenic
972239909 4:37179054-37179076 ACAAGCTGTGGCCATGCATCCGG + Intergenic
980761496 4:137239340-137239362 CGCTGCTCTGGCCATCCAAGTGG + Intergenic
983550228 4:169010036-169010058 CACAGCTCTGCCAATGCCTCGGG + Exonic
992197516 5:74354593-74354615 CTCGGCTGTGGCCAGGCATCTGG + Intergenic
999967995 5:156830452-156830474 CTCAGATCTGGGCCTGCATCAGG + Intergenic
1001101788 5:168820306-168820328 CTGAGCTCAGGCCATTCATCAGG - Intronic
1001278035 5:170365230-170365252 CGCAGAGCTGGCCTTGAATCTGG + Intronic
1001313768 5:170628872-170628894 GGGAGCTCTGGCCGTGCATGAGG + Intronic
1003356914 6:5382040-5382062 AGCAGATCTTGCCATCCATCTGG + Intronic
1004951512 6:20677702-20677724 CTTAGCTCTCGCCATGCATGGGG - Intronic
1014531629 6:122565853-122565875 TTCAGATCTGGCCATGCCTCAGG - Intronic
1018394251 6:163365285-163365307 AGCAGCTCTGGCCAAGCTCCTGG - Intergenic
1019527101 7:1485289-1485311 CACAGCCCTGGCCCTGCAGCAGG - Exonic
1023743570 7:43302246-43302268 GGCAGCTCAGGCCATGGATGAGG + Intronic
1023805216 7:43868371-43868393 CTCAGCTCGGGACATGCACCTGG + Intronic
1024873941 7:53999525-53999547 CACTGCTCTGGCCATGCAGGAGG - Intergenic
1026868855 7:73838775-73838797 GGCAGGTCTGGGCAGGCATCTGG - Intronic
1026973324 7:74480834-74480856 CTCAGCTCGGGCTGTGCATCAGG - Intronic
1027070418 7:75157162-75157184 CGCTACTCTGGCCCTGCCTCTGG + Intergenic
1029744854 7:102511222-102511244 GGCAGCTCTGGCCATGAACTTGG + Intronic
1029762846 7:102610384-102610406 GGCAGCTCTGGCCATGAACTTGG + Intronic
1030107783 7:106001028-106001050 CGCAGCTCTGGACATGACCCTGG + Intronic
1032279753 7:130491332-130491354 CGCTGCTGTGGCCAGGCGTCTGG + Intronic
1032374294 7:131394565-131394587 CGCACCTCCTGCCATGCGTCTGG + Intronic
1034256448 7:149727263-149727285 CACAGCTCTGGCCAGGCCTGTGG + Intronic
1034746709 7:153529558-153529580 CCCAGCACTGGCCTTGCTTCTGG + Intergenic
1035235281 7:157493882-157493904 AGCAGCTCTGGGCATGAAGCAGG - Intergenic
1035252374 7:157605757-157605779 CCCAGCTCTGGCTATGCCTGGGG + Intronic
1035459342 7:159029669-159029691 AGCAGCTCTGGCTCTGCCTCAGG - Exonic
1038498999 8:28027719-28027741 CTCAGCTCTAGCCATGGACCTGG + Intronic
1040609110 8:48964784-48964806 TGCAGCACTGGCCATCCATGTGG + Intergenic
1045407461 8:101880481-101880503 CTCCGCTCTGGCCATGCTCCAGG - Intronic
1051924838 9:22311386-22311408 CACAGCTCTGGACATGGATGTGG + Intergenic
1053895234 9:42736174-42736196 CGCAGCCCTGGCCATACCACTGG - Intergenic
1054805307 9:69391666-69391688 CGCAGCTCTGGAGGTGCAGCAGG - Exonic
1055147940 9:72958824-72958846 GGGAGCTCTGCCCCTGCATCAGG + Intronic
1055637877 9:78296220-78296242 AGCAGCTCTGGCCCTGCGCCTGG + Intergenic
1057907515 9:98994066-98994088 CTCAGCCCTGGCTGTGCATCAGG + Intronic
1059458264 9:114413325-114413347 CCCAGCTCTGGCCGTGCCACCGG - Intronic
1060410425 9:123396324-123396346 CAGAGCTCTGCCCATGCACCAGG + Intronic
1062252326 9:135604613-135604635 CGCACCCCTGGCCGTGCATGGGG + Intergenic
1189273306 X:39767085-39767107 GACAGCTCTGGCCCTGCACCAGG + Intergenic
1191109833 X:56795798-56795820 CGCACCTCTGGCCCTGCCTAGGG + Intergenic
1191213114 X:57909750-57909772 CGCAGCTCTGGGCAGTCACCCGG + Exonic
1200848300 Y:7855253-7855275 GGCACCTCTGTCCATGCTTCTGG + Intergenic