ID: 1108058088

View in Genome Browser
Species Human (GRCh38)
Location 13:46505163-46505185
Sequence ACGCAGCTCTGGCCATGCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108058088_1108058094 30 Left 1108058088 13:46505163-46505185 CCGATGCATGGCCAGAGCTGCGT 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1108058094 13:46505216-46505238 AAAGAAAATTCATTCTCCCCTGG 0: 1
1: 0
2: 0
3: 50
4: 419
1108058088_1108058091 4 Left 1108058088 13:46505163-46505185 CCGATGCATGGCCAGAGCTGCGT 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1108058091 13:46505190-46505212 CACTACACCGGTATGCTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1108058088_1108058092 7 Left 1108058088 13:46505163-46505185 CCGATGCATGGCCAGAGCTGCGT 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1108058092 13:46505193-46505215 TACACCGGTATGCTTGAAGGTGG 0: 1
1: 0
2: 3
3: 2
4: 39
1108058088_1108058090 -8 Left 1108058088 13:46505163-46505185 CCGATGCATGGCCAGAGCTGCGT 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG 0: 1
1: 0
2: 4
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108058088 Original CRISPR ACGCAGCTCTGGCCATGCAT CGG (reversed) Intergenic
904556954 1:31371659-31371681 ACTCAGCTCTGGCCCAGCTTTGG + Intronic
906248530 1:44293863-44293885 ACGCACCTCTGGCCTGGCACGGG + Intronic
907283996 1:53368751-53368773 ACGCAGCTCTGCCCTTGACTGGG + Intergenic
913690988 1:121279644-121279666 TCTCAGCTGTGGCCAAGCATGGG + Intronic
914146551 1:145000319-145000341 TCTCAGCTGTGGCCAAGCATGGG - Intronic
915974368 1:160375286-160375308 GGGGAGCTATGGCCATGCATGGG - Intergenic
919751841 1:201042632-201042654 AGGCAGCCCTGGCCATGAAAAGG + Intronic
920478311 1:206298119-206298141 TCTCAGCTGTGGCCAAGCATGGG + Intronic
923272871 1:232373283-232373305 ACACAGCTCTGGACATACAGAGG + Intergenic
1063818462 10:9806200-9806222 ACGCAGCTATGGACATCCAGAGG + Intergenic
1073445051 10:103575530-103575552 AAGCAGGTCAGGCCATGGATGGG + Intronic
1074963318 10:118467136-118467158 TAGCAGCTCTGGCACTGCATAGG + Intergenic
1075703546 10:124484506-124484528 ACCCAGCTCTGTCCATTCCTTGG + Intronic
1077150558 11:1071248-1071270 CCACAGCTCTGGCCCTGCCTTGG - Intergenic
1077466288 11:2735270-2735292 AGGCATCTCTGGCCATCCAGGGG - Intronic
1078605766 11:12774151-12774173 AGGAGGCTCTGGTCATGCATGGG + Intronic
1081561496 11:44221250-44221272 ACACAGCGCTGGCCATGGAAAGG - Intronic
1084964736 11:72738703-72738725 AGCCAGCTCTGGCCAGGCCTGGG + Intronic
1087661761 11:100996966-100996988 AAGCAGCTGTGGACCTGCATGGG - Intergenic
1089776779 11:120843236-120843258 AGGGAGCTCTGGCCCTGCCTGGG - Intronic
1091230926 11:133987514-133987536 AGGCTGCTCTGTCAATGCATTGG - Intergenic
1101512171 12:105403301-105403323 ACCCAGCTCTGGCAGTACATTGG + Intergenic
1104803790 12:131572200-131572222 AGGCAGCCCTGGCCATGAGTGGG - Intergenic
1106841595 13:33690432-33690454 ACGCAGCTGTGGACATGTAATGG + Intergenic
1106915098 13:34505276-34505298 TCCCAGCTCTGGCTAAGCATTGG + Intergenic
1108058088 13:46505163-46505185 ACGCAGCTCTGGCCATGCATCGG - Intergenic
1119442828 14:74640093-74640115 ACGCATCTCTTGCCAGGCACTGG - Intergenic
1122349982 14:101083541-101083563 ACGCAGCCCTGCCAATGCCTTGG + Intergenic
1202929134 14_KI270725v1_random:23320-23342 ACGCAGCTCCGCCCTTGCAAAGG - Intergenic
1125272361 15:37953103-37953125 AAGCACCTCTGGACATGCACAGG + Intronic
1130336131 15:82958722-82958744 AGGGAGCTCTGGCAATGCAAGGG + Intronic
1142231183 16:88901011-88901033 AGGCAGCTCTGGCCTTGGAGGGG - Intronic
1153524011 18:5977984-5978006 ATGCAGCTCTGGGGATGAATGGG - Intronic
1156666869 18:39419509-39419531 AGGCTTCTCTGGCCATGCAGTGG + Intergenic
1162490683 19:10989556-10989578 AAGCAGCCGTGGCCATCCATGGG + Intronic
1163003565 19:14383802-14383824 ACCCAGCTCAGCCCATGCAGAGG + Intronic
1166707645 19:44917017-44917039 ACCCAGGTCTGGCCAAGCTTGGG - Intronic
1168028024 19:53657677-53657699 ATGGAGATCTGGCAATGCATGGG + Intergenic
1168614469 19:57826708-57826730 ACGCAGGTCTGGCCGTGCCTCGG + Intronic
925504927 2:4551862-4551884 AAGCAGGTGTGGCCATTCATTGG - Intergenic
925823917 2:7828273-7828295 ACAAAGCTCTTGCCATCCATTGG + Intergenic
925944132 2:8845153-8845175 AAGCAGCTGTGGCCAGGCAGTGG - Intergenic
927900113 2:26812910-26812932 AAGAAGCTCGGGACATGCATGGG - Intergenic
929587869 2:43127358-43127380 ACGCGGCTCTGGCCAAGGATGGG + Intergenic
930110543 2:47675279-47675301 GCCCAGCTCTGGCCAGGCCTTGG - Intergenic
935650592 2:105378594-105378616 ACGCAGCCCTGGGCAGGCAAAGG - Intronic
935901628 2:107799142-107799164 ACCAAGATCTGACCATGCATAGG + Intergenic
940855497 2:158725814-158725836 GCCCAGCGCTGGCCAGGCATTGG - Intergenic
940961916 2:159795891-159795913 ACTCAGCTCATGCCAGGCATAGG + Intronic
944667429 2:201969191-201969213 ACGCAGCTCTGCCCTCACATCGG - Intergenic
947451597 2:230213597-230213619 ACCCAGCACTAGCCATGCAAGGG - Intronic
948607450 2:239145227-239145249 ACACAGCTGGGGCGATGCATGGG - Intronic
949027159 2:241771754-241771776 AGGCAGCTCTGGCCCTGCCTGGG - Intergenic
1168904564 20:1392848-1392870 ACGCAGGTCTGGCCGCGCTTGGG + Exonic
1170571164 20:17633586-17633608 ACGCAGAGCTGGCCAAGCTTCGG - Exonic
1172448680 20:35006634-35006656 ATGGAGCTCAGACCATGCATTGG + Intronic
1175157981 20:56986184-56986206 ATGCAGAACTGGCCTTGCATGGG - Intergenic
1176278230 20:64286533-64286555 ACGCAGCTCTGCCCCCGCAAAGG - Intronic
1176591158 21:8651918-8651940 ACGCAGCTCCGCCCTTGCAAAGG - Intergenic
1178870555 21:36370956-36370978 AAGCAACTCAGGCCAGGCATGGG - Intronic
1180274004 22:10629029-10629051 ACGCAGCTCCGCCCTTGCAAAGG - Intergenic
1180799268 22:18624232-18624254 ACCCAGCTGCTGCCATGCATTGG - Intergenic
1181053836 22:20250145-20250167 ACGGAGCTCTGGCCTTGGCTGGG - Intronic
1181222450 22:21371034-21371056 ACCCAGCTGCTGCCATGCATTGG + Intergenic
1181638206 22:24184020-24184042 ACCCAGCTGCTGCCATGCATTGG + Intronic
951563683 3:23991746-23991768 AGGCAGCACTGGCAATGGATAGG - Intergenic
952601166 3:35084992-35085014 ACTCAGCTGTGGCCATAGATAGG + Intergenic
954275791 3:49540683-49540705 TCACAGCTCTAGGCATGCATTGG + Intergenic
961384032 3:126514430-126514452 ACACAGCTCTCACCATGCACAGG - Intronic
964017054 3:151960529-151960551 GCCCAGATCTGGTCATGCATGGG - Intergenic
967613550 3:191537417-191537439 TCTCAGCACTGGCCATGCATTGG - Intergenic
969434761 4:7182081-7182103 ACACAGCTCTGGCAATACAGAGG + Intergenic
974431464 4:61802620-61802642 ACCCAGGTCTGGCCATTCAGAGG - Intronic
985792447 5:1937527-1937549 GCCCAGATCTGGCCATGTATGGG - Intergenic
993633730 5:90318792-90318814 AAGCATCTATGCCCATGCATGGG + Intergenic
1001221785 5:169906620-169906642 ACTCAGTTTTGGCCAGGCATGGG - Intronic
1002422865 5:179158690-179158712 ACGCCTCTGTGGCCCTGCATGGG + Intronic
1002754689 6:148131-148153 ACGCAGCTCTGCCCCCGCAAAGG + Intergenic
1003193179 6:3891900-3891922 AGGCAGCCCTGGCCCTGCAGTGG + Intergenic
1004951513 6:20677703-20677725 ACTTAGCTCTCGCCATGCATGGG - Intronic
1005173414 6:23014732-23014754 TTGCAGCTCTGGCCATGTGTGGG - Intergenic
1015295010 6:131581231-131581253 AAGCATCTCTGGCCATGCCAGGG + Exonic
1018070237 6:160158123-160158145 ACCCAGTTCTGCCCCTGCATTGG + Intronic
1022974066 7:35541211-35541233 GCACAGCTCTGGCATTGCATAGG - Intergenic
1023917930 7:44604435-44604457 ATGAAGTTCTGGCCAGGCATGGG + Intergenic
1026994328 7:74606024-74606046 TCCCAGCTCTGGGCATGGATGGG - Intergenic
1028253278 7:88560304-88560326 AGACAGCTGTGGCAATGCATGGG + Intergenic
1030323861 7:108199481-108199503 ACGCAGCTCTGCTCACGCATTGG - Intronic
1032939196 7:136768755-136768777 TAGCATCTCTGGACATGCATGGG + Intergenic
1034980313 7:155471604-155471626 ACGCAGGTGAGGCCATCCATGGG + Intergenic
1035252372 7:157605756-157605778 GCCCAGCTCTGGCTATGCCTGGG + Intronic
1035363287 7:158328503-158328525 ACGCTGCTCTGCAGATGCATAGG - Intronic
1035738152 8:1904134-1904156 ATGCAGCTTAGCCCATGCATAGG - Intronic
1040450609 8:47542358-47542380 ACGCAACTCTGGGCATTCACAGG - Intronic
1047518318 8:125574746-125574768 ACTCACCTCTGGCTATGCCTGGG + Intergenic
1053690534 9:40584561-40584583 ACGCAGCTCCGCCCTTGCAAAGG - Intergenic
1054274281 9:63052932-63052954 ACGCAGCTCCGCCCTTGCAAAGG + Intergenic
1054301790 9:63385535-63385557 ACGCAGCTCCGCCCTTGCAAAGG - Intergenic
1054400559 9:64712037-64712059 ACGCAGCTCCGCCCTTGCAAAGG - Intergenic
1054434165 9:65196352-65196374 ACGCAGCTCCGCCCTTGCAAAGG - Intergenic
1054496224 9:65825328-65825350 ACGCAGCTCCGCCCTTGCAAAGG + Intergenic
1057618200 9:96612400-96612422 ATGCAGCCCTGGCCATCAATGGG + Intronic
1060527832 9:124330527-124330549 AGGCAGCACGGGCCCTGCATGGG - Intronic
1061681764 9:132245987-132246009 AGGCAGCCCTGGGCAGGCATTGG + Intergenic
1062252325 9:135604612-135604634 GCGCACCCCTGGCCGTGCATGGG + Intergenic
1062282446 9:135758077-135758099 ACGCAGGTGTGGCCAGGCGTGGG + Intronic
1203621184 Un_KI270749v1:130683-130705 ACGCAGCTCCGCCCTTGCAAAGG - Intergenic
1185577094 X:1183005-1183027 ACACAGCCCTGTCCACGCATTGG - Intergenic
1186766499 X:12775974-12775996 ATGCAGCTCAGGACGTGCATGGG - Intergenic
1190633491 X:52411703-52411725 ACGCAGCTATGGCCTTGCTGTGG - Intergenic
1191109832 X:56795797-56795819 GCGCACCTCTGGCCCTGCCTAGG + Intergenic
1193892063 X:87060720-87060742 ACATAGTTTTGGCCATGCATTGG + Intergenic
1200938413 Y:8758564-8758586 ACGCAGAGCTGGCCAGGTATTGG + Intergenic