ID: 1108058090

View in Genome Browser
Species Human (GRCh38)
Location 13:46505178-46505200
Sequence AGCTGCGTGTTGCACTACAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 4, 3: 2, 4: 44}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108058086_1108058090 -3 Left 1108058086 13:46505158-46505180 CCTTCCCGATGCATGGCCAGAGC 0: 1
1: 0
2: 1
3: 10
4: 88
Right 1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG 0: 1
1: 0
2: 4
3: 2
4: 44
1108058087_1108058090 -7 Left 1108058087 13:46505162-46505184 CCCGATGCATGGCCAGAGCTGCG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG 0: 1
1: 0
2: 4
3: 2
4: 44
1108058083_1108058090 14 Left 1108058083 13:46505141-46505163 CCCAGGAGAAGGGTGCACCTTCC 0: 1
1: 0
2: 2
3: 13
4: 151
Right 1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG 0: 1
1: 0
2: 4
3: 2
4: 44
1108058084_1108058090 13 Left 1108058084 13:46505142-46505164 CCAGGAGAAGGGTGCACCTTCCC 0: 1
1: 0
2: 2
3: 18
4: 176
Right 1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG 0: 1
1: 0
2: 4
3: 2
4: 44
1108058088_1108058090 -8 Left 1108058088 13:46505163-46505185 CCGATGCATGGCCAGAGCTGCGT 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG 0: 1
1: 0
2: 4
3: 2
4: 44
1108058081_1108058090 21 Left 1108058081 13:46505134-46505156 CCATCTCCCCAGGAGAAGGGTGC 0: 1
1: 0
2: 3
3: 28
4: 238
Right 1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG 0: 1
1: 0
2: 4
3: 2
4: 44
1108058082_1108058090 15 Left 1108058082 13:46505140-46505162 CCCCAGGAGAAGGGTGCACCTTC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG 0: 1
1: 0
2: 4
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108058090 Original CRISPR AGCTGCGTGTTGCACTACAC CGG Intergenic
900373354 1:2342258-2342280 TGCTGCCTGGTGCCCTACACAGG - Intronic
901855321 1:12040902-12040924 AGCTGTGTGTTGCAGAACACTGG + Intergenic
910272271 1:85409599-85409621 TCCTGCTTGTTGCTCTACACCGG + Intronic
912713228 1:111964352-111964374 ACCTGCGGGCTGCAGTACACAGG + Intronic
915596363 1:156898526-156898548 AGCAGCCTGCTGCACTCCACAGG - Intronic
924834538 1:247635611-247635633 ACCTGCGTGTTCCACTTCCCTGG - Intergenic
1062871209 10:906483-906505 ACCTGTGGGTTGCACCACACTGG - Intronic
1066101950 10:32125296-32125318 TGCTGTCTGTTCCACTACACTGG - Intergenic
1076300449 10:129421617-129421639 AGCTGCATGGTGCACTACCTGGG + Intergenic
1085072448 11:73559709-73559731 AGATGGTTGTTGCACAACACTGG + Intronic
1085558093 11:77443843-77443865 AGCTGCTTGGTGCCCTAGACAGG - Intronic
1089209476 11:116790675-116790697 AGCCGCGTGGTGCACCACACCGG - Exonic
1091635916 12:2196544-2196566 AGCTGTGTTATGCACTAAACAGG - Intronic
1100169115 12:91952994-91953016 AGCTGCCTGAGGCACCACACAGG - Intergenic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1143917522 17:10304920-10304942 AGCTGCATGCTCCACTCCACTGG + Intronic
1146848013 17:36196860-36196882 TGCTGAGTGTTGCACAACTCAGG + Intronic
1152784990 17:82243069-82243091 AGCTGTGTGTTGAAGTACAGAGG - Exonic
1165645341 19:37431253-37431275 AGCTGCGAGCTGCACTACCTCGG - Intronic
1168614466 19:57826693-57826715 ACCTGCGTGGTGCACTACACCGG - Intronic
925018258 2:547805-547827 AGGAGAGTGTTTCACTACACAGG + Intergenic
926097929 2:10094545-10094567 AGCTGCCTGTTTCAGAACACTGG + Intergenic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
932557617 2:72839287-72839309 AGCTGCGTTCTGCACCACAATGG - Intergenic
936846985 2:116847781-116847803 AGATGAGTGTTACAATACACAGG - Intergenic
937414062 2:121700225-121700247 AGGTGCGTGCTGGACTCCACTGG + Intergenic
939853604 2:147329980-147330002 GGCTGCGTTTAGCCCTACACAGG - Intergenic
1168904560 20:1392833-1392855 ACCTGCGTGGTGCACTACACCGG - Exonic
1170386870 20:15828755-15828777 AGCAGCGTGTTGCTGAACACAGG - Intronic
1172311759 20:33923808-33923830 AGCTGACTCTTGCACAACACAGG + Intergenic
1176246407 20:64099327-64099349 AGCTGCCTGCTGCACTTCCCGGG - Exonic
1177744393 21:25193732-25193754 AGCTGCAGGTTGCAGTTCACTGG - Intergenic
956735509 3:72234570-72234592 GGCTGAGTGTTGCACTGCAGAGG - Intergenic
963778499 3:149464029-149464051 ACCTGCGTGATGCACTACACCGG - Intergenic
966881525 3:184353699-184353721 ACCTGCGTTTGGCACTGCACAGG - Exonic
972973959 4:44610530-44610552 AGCTGCCTGTAGCACCAAACTGG + Intergenic
987840481 5:23217195-23217217 AGCTGCGAGTTGCATTCCAGGGG - Intergenic
990024714 5:51172316-51172338 AGCTGTGTGTTGCACAAAAGTGG - Intergenic
1004057207 6:12151831-12151853 AGCTGCATGTGGCTCTCCACTGG - Intronic
1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG + Exonic
1009919393 6:70038779-70038801 TACTGGTTGTTGCACTACACTGG + Intronic
1027867253 7:83663400-83663422 AGCTGTGAGGTGCACAACACAGG + Intergenic
1028283638 7:88966908-88966930 TGCAGCTTGTTGCACTTCACAGG + Intronic
1038781104 8:30569037-30569059 AGCTGCGTGGTTCATTACCCAGG + Intronic
1045415976 8:101967960-101967982 ATCTGGGTGTCACACTACACTGG - Intronic
1056294155 9:85174709-85174731 AACTTCATGTTCCACTACACTGG - Intergenic
1060229439 9:121815690-121815712 AGCTGAGTGTTGCTAAACACAGG - Intergenic
1062427597 9:136513020-136513042 AACTGCCTGCTGCCCTACACAGG - Exonic
1201731093 Y:17204052-17204074 AGGTGATTGTTGCACAACACTGG + Intergenic