ID: 1108058091

View in Genome Browser
Species Human (GRCh38)
Location 13:46505190-46505212
Sequence CACTACACCGGTATGCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108058087_1108058091 5 Left 1108058087 13:46505162-46505184 CCCGATGCATGGCCAGAGCTGCG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1108058091 13:46505190-46505212 CACTACACCGGTATGCTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1108058084_1108058091 25 Left 1108058084 13:46505142-46505164 CCAGGAGAAGGGTGCACCTTCCC 0: 1
1: 0
2: 2
3: 18
4: 176
Right 1108058091 13:46505190-46505212 CACTACACCGGTATGCTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1108058088_1108058091 4 Left 1108058088 13:46505163-46505185 CCGATGCATGGCCAGAGCTGCGT 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1108058091 13:46505190-46505212 CACTACACCGGTATGCTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1108058082_1108058091 27 Left 1108058082 13:46505140-46505162 CCCCAGGAGAAGGGTGCACCTTC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1108058091 13:46505190-46505212 CACTACACCGGTATGCTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1108058089_1108058091 -7 Left 1108058089 13:46505174-46505196 CCAGAGCTGCGTGTTGCACTACA 0: 1
1: 0
2: 4
3: 2
4: 52
Right 1108058091 13:46505190-46505212 CACTACACCGGTATGCTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1108058086_1108058091 9 Left 1108058086 13:46505158-46505180 CCTTCCCGATGCATGGCCAGAGC 0: 1
1: 0
2: 1
3: 10
4: 88
Right 1108058091 13:46505190-46505212 CACTACACCGGTATGCTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1108058083_1108058091 26 Left 1108058083 13:46505141-46505163 CCCAGGAGAAGGGTGCACCTTCC 0: 1
1: 0
2: 2
3: 13
4: 151
Right 1108058091 13:46505190-46505212 CACTACACCGGTATGCTTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108058091 Original CRISPR CACTACACCGGTATGCTTGA AGG Intergenic
903442821 1:23401243-23401265 CACCTCACCGGTATGCATGGAGG - Intronic
909170679 1:72290028-72290050 CAGTTCACCAGTATGCATGATGG + Intergenic
918287469 1:183071750-183071772 CACTTCAGCACTATGCTTGAGGG - Intronic
919581335 1:199378044-199378066 CACTTCAGCATTATGCTTGAGGG - Intergenic
1070667733 10:78357256-78357278 CACTTCACCGGCATTCTTCAGGG - Intergenic
1083797583 11:65026394-65026416 CAAGACCCAGGTATGCTTGAAGG + Intronic
1092520769 12:9270245-9270267 CACTCCACCATTTTGCTTGATGG + Intergenic
1108058091 13:46505190-46505212 CACTACACCGGTATGCTTGAAGG + Intergenic
1111747413 13:92287888-92287910 ACATACACTGGTATGCTTGATGG + Intronic
1138018175 16:53450477-53450499 CACTGCACATGTATGCTTCATGG - Intronic
1143380638 17:6493968-6493990 CACGACACAGGGATGCTAGAGGG + Intronic
1150848925 17:68686475-68686497 CACTAAACCTCTAGGCTTGAAGG + Intergenic
1156760039 18:40577706-40577728 CACGCCACCAGCATGCTTGAGGG - Intergenic
1157790118 18:50524065-50524087 TACCACACTGGTATCCTTGAAGG - Intergenic
926705166 2:15832086-15832108 CACTTCAGCGCTATGCTTGGGGG + Intergenic
936907463 2:117553703-117553725 CTATACACCGGTATCCTTGAGGG + Intergenic
938298995 2:130197120-130197142 CATTACACCCGTAGGCTTCAAGG - Intronic
1170500918 20:16974727-16974749 CACTACCCCTGCAGGCTTGAGGG + Intergenic
1170828436 20:19818040-19818062 CACTACACAGGTAGGCTATATGG + Intergenic
1171141341 20:22746464-22746486 CTCTCCACAGGGATGCTTGAGGG - Intergenic
953396389 3:42574259-42574281 CACTGCACCTGGCTGCTTGAAGG - Intronic
956947979 3:74245461-74245483 CACTACACTGTAATGATTGAGGG + Intergenic
957175732 3:76805999-76806021 CATTACACGGTTCTGCTTGAAGG + Intronic
958424258 3:93963510-93963532 CACTACAAAGGAATACTTGAGGG + Intronic
971070168 4:23081793-23081815 CAGTTGACTGGTATGCTTGAGGG - Intergenic
974410810 4:61539179-61539201 CACTGCACAGGTTTGCATGAAGG - Intronic
980325422 4:131338695-131338717 CACTACACAGGTAGGCTATATGG + Intergenic
984489413 4:180413955-180413977 CATCACACCGATATCCTTGAGGG - Intergenic
988162214 5:27533317-27533339 TACTACACTGGTATGCTGGTGGG + Intergenic
995354450 5:111222851-111222873 TACTACACAGCTATGCTGGATGG - Intergenic
997707808 5:135975001-135975023 CACTACAATGGTTTGTTTGACGG - Intergenic
999491853 5:152058817-152058839 CACTATACCGTTTTGCTTAATGG - Intergenic
1016690762 6:146935248-146935270 CACTTCACCACTATGCTTGGGGG + Intergenic
1017302332 6:152876168-152876190 CACTTCAGCAGTATGCTTGGGGG - Intergenic
1027847189 7:83395696-83395718 CACTTCAGCGCTATGCTTGGGGG - Intronic
1031342078 7:120615163-120615185 AACTACACCAGAATGCTTCAAGG + Intronic
1032494141 7:132348359-132348381 CATTTCTCCTGTATGCTTGAGGG + Intronic
1041800246 8:61790301-61790323 TCCCACACCGGCATGCTTGAAGG - Intergenic
1043782252 8:84350489-84350511 TACTACACTGGTCTGCTTGTGGG + Intronic
1054852167 9:69858465-69858487 CACTTCACCACCATGCTTGAGGG - Intronic
1188414038 X:29910203-29910225 CACAATACAGGTATACTTGAGGG + Intronic