ID: 1108058092

View in Genome Browser
Species Human (GRCh38)
Location 13:46505193-46505215
Sequence TACACCGGTATGCTTGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 3, 3: 2, 4: 39}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108058086_1108058092 12 Left 1108058086 13:46505158-46505180 CCTTCCCGATGCATGGCCAGAGC 0: 1
1: 0
2: 1
3: 10
4: 88
Right 1108058092 13:46505193-46505215 TACACCGGTATGCTTGAAGGTGG 0: 1
1: 0
2: 3
3: 2
4: 39
1108058084_1108058092 28 Left 1108058084 13:46505142-46505164 CCAGGAGAAGGGTGCACCTTCCC 0: 1
1: 0
2: 2
3: 18
4: 176
Right 1108058092 13:46505193-46505215 TACACCGGTATGCTTGAAGGTGG 0: 1
1: 0
2: 3
3: 2
4: 39
1108058089_1108058092 -4 Left 1108058089 13:46505174-46505196 CCAGAGCTGCGTGTTGCACTACA 0: 1
1: 0
2: 4
3: 2
4: 52
Right 1108058092 13:46505193-46505215 TACACCGGTATGCTTGAAGGTGG 0: 1
1: 0
2: 3
3: 2
4: 39
1108058087_1108058092 8 Left 1108058087 13:46505162-46505184 CCCGATGCATGGCCAGAGCTGCG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1108058092 13:46505193-46505215 TACACCGGTATGCTTGAAGGTGG 0: 1
1: 0
2: 3
3: 2
4: 39
1108058083_1108058092 29 Left 1108058083 13:46505141-46505163 CCCAGGAGAAGGGTGCACCTTCC 0: 1
1: 0
2: 2
3: 13
4: 151
Right 1108058092 13:46505193-46505215 TACACCGGTATGCTTGAAGGTGG 0: 1
1: 0
2: 3
3: 2
4: 39
1108058082_1108058092 30 Left 1108058082 13:46505140-46505162 CCCCAGGAGAAGGGTGCACCTTC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1108058092 13:46505193-46505215 TACACCGGTATGCTTGAAGGTGG 0: 1
1: 0
2: 3
3: 2
4: 39
1108058088_1108058092 7 Left 1108058088 13:46505163-46505185 CCGATGCATGGCCAGAGCTGCGT 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1108058092 13:46505193-46505215 TACACCGGTATGCTTGAAGGTGG 0: 1
1: 0
2: 3
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108058092 Original CRISPR TACACCGGTATGCTTGAAGG TGG Intergenic
909445508 1:75744179-75744201 GACACAGGTTTGCTAGAAGGAGG + Intronic
922326793 1:224535780-224535802 TCCACCTGTAGGCGTGAAGGAGG + Intronic
922922814 1:229321341-229321363 CACACTAGTAGGCTTGAAGGAGG + Exonic
923602960 1:235419775-235419797 TACACCGGGCTCCTTGAAAGGGG + Intronic
1063958535 10:11286805-11286827 TTCACAGGGATGCTTGAAAGTGG - Intronic
1076534513 10:131168223-131168245 TACACGTCTGTGCTTGAAGGGGG + Intronic
1096710901 12:53454804-53454826 GACACCGGTGTGATTGAAGGTGG + Exonic
1106477728 13:30112711-30112733 TACACCGGCATGTCTGTAGGCGG - Intergenic
1108058092 13:46505193-46505215 TACACCGGTATGCTTGAAGGTGG + Intergenic
1108883305 13:55148020-55148042 TAGACCGGAATGCTTGAATTAGG - Intergenic
1108959477 13:56206056-56206078 TACACAGGAATCTTTGAAGGTGG - Intergenic
1115802701 14:37013420-37013442 TACACCAGGATGCTCCAAGGGGG + Intronic
1129970842 15:79776550-79776572 TACACTGGGCTGCTTGGAGGTGG + Intergenic
1131729973 15:95269206-95269228 TTAACTGTTATGCTTGAAGGTGG + Intergenic
1155604518 18:27588808-27588830 TACACCTGTATGCTTGATATGGG + Intergenic
1164911939 19:32020030-32020052 TACACCTGTAAGTTTGAAGGGGG - Intergenic
1168614463 19:57826678-57826700 TACACCGGGATGCTTGAAGATGG - Intronic
928712195 2:34019647-34019669 TTCACCTGTAGGCTTGAATGGGG - Intergenic
932490640 2:72117856-72117878 AACACAGGAATGCATGAAGGGGG - Intergenic
945838262 2:214857911-214857933 TACACTGGCATGCTTTTAGGGGG - Intergenic
946181642 2:217952670-217952692 TACGCTGGTAGGCTTCAAGGTGG + Intronic
1168902327 20:1375588-1375610 TTCACAGGGATGCTTGAAGATGG - Exonic
1169571226 20:6908294-6908316 AACACAGGTATGCCTGAATGAGG - Intergenic
1170305113 20:14929727-14929749 AACTCGGGTATGCTTGAAAGGGG + Intronic
1178963999 21:37097991-37098013 TACAGCGGTATTCTCCAAGGTGG - Intronic
951620135 3:24592487-24592509 TACACTGAAATACTTGAAGGAGG - Intergenic
963778496 3:149464014-149464036 TACACCGGGATGCTTGAAGATGG - Intergenic
977850399 4:101820631-101820653 CACTGGGGTATGCTTGAAGGTGG - Intronic
980780107 4:137482725-137482747 TACACAGTTATGCTCGACGGGGG - Intergenic
987916003 5:24215870-24215892 TAGACCTGTATGTTTGAAGTGGG + Intergenic
998871880 5:146560751-146560773 TCCACCTCTATGCTTGATGGGGG - Intergenic
1005601010 6:27425975-27425997 TACACCAGTGTGCTTGAAATTGG - Intergenic
1009397002 6:63211635-63211657 TACACCGGGATGCTTGAAGATGG + Exonic
1016408037 6:143751563-143751585 TACACCTGTTTACTAGAAGGAGG + Intronic
1019275668 7:174272-174294 CACACAGGTATGCACGAAGGAGG + Intergenic
1026888261 7:73967212-73967234 TACACAGGAAAGCTGGAAGGGGG - Intergenic
1028064509 7:86365763-86365785 TTCACAGGTGTGGTTGAAGGCGG + Intergenic
1031693712 7:124821909-124821931 TACAGCAGTATAATTGAAGGTGG + Intergenic
1036768974 8:11565924-11565946 CACACCGGGGTGCTGGAAGGAGG + Intergenic
1037012682 8:13863303-13863325 AACACTGGTATGATTGAAAGGGG + Intergenic
1043471335 8:80566075-80566097 CACACCGGGAGGCCTGAAGGTGG - Intergenic
1046236689 8:111433425-111433447 TGCAGGGGTGTGCTTGAAGGTGG - Intergenic
1056932921 9:90893540-90893562 AACCCAGGTATGGTTGAAGGGGG + Intronic
1189735230 X:44063337-44063359 TACAGCCGTATGATTGATGGTGG + Intergenic
1192061341 X:67830443-67830465 TAAACTGGTGTGCTTGTAGGAGG - Intergenic