ID: 1108063459

View in Genome Browser
Species Human (GRCh38)
Location 13:46554100-46554122
Sequence GGGAACTCCAGCGCGGACAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108063455_1108063459 -9 Left 1108063455 13:46554086-46554108 CCCCGCGCAGGGCTGGGAACTCC 0: 1
1: 0
2: 3
3: 17
4: 168
Right 1108063459 13:46554100-46554122 GGGAACTCCAGCGCGGACAGCGG 0: 1
1: 0
2: 0
3: 5
4: 82
1108063453_1108063459 -3 Left 1108063453 13:46554080-46554102 CCTGGGCCCCGCGCAGGGCTGGG 0: 1
1: 0
2: 12
3: 103
4: 1188
Right 1108063459 13:46554100-46554122 GGGAACTCCAGCGCGGACAGCGG 0: 1
1: 0
2: 0
3: 5
4: 82
1108063456_1108063459 -10 Left 1108063456 13:46554087-46554109 CCCGCGCAGGGCTGGGAACTCCA 0: 1
1: 0
2: 0
3: 23
4: 208
Right 1108063459 13:46554100-46554122 GGGAACTCCAGCGCGGACAGCGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108063459 Original CRISPR GGGAACTCCAGCGCGGACAG CGG Intronic
900533637 1:3166706-3166728 GGGAACCACAGCGCGGCCTGGGG + Intronic
900745333 1:4356859-4356881 GGGATCTCCAGGGAGGCCAGAGG - Intergenic
905909418 1:41643636-41643658 GGGAGCTGCAGCACAGACAGAGG - Intronic
908004777 1:59716707-59716729 GGGAACAAGAGAGCGGACAGGGG + Intronic
908762251 1:67522984-67523006 GGCCACTCCAGCGTGGCCAGAGG + Intergenic
914226138 1:145721021-145721043 GTGAGCCCCAGCGCGGGCAGGGG - Intronic
921049492 1:211500950-211500972 GGGAACCCCATAGAGGACAGGGG - Intergenic
923134988 1:231109694-231109716 GGGAACTCCAGTACAGAGAGTGG - Intergenic
924387644 1:243513975-243513997 GGGAACCCCAGAGGTGACAGAGG + Intronic
1065140212 10:22713482-22713504 GGGCTCTCCAGCCCGCACAGCGG + Intronic
1065726001 10:28668584-28668606 GAGAACCACAGCGCGAACAGGGG + Intergenic
1067692279 10:48509547-48509569 GGGAGCTCCAGCCAGGACAATGG + Intronic
1072555708 10:96512675-96512697 GGCAGTTCCAGCACGGACAGAGG - Intronic
1076144304 10:128104969-128104991 GGGAACTCCAGTGCAGAAATTGG - Exonic
1076144488 10:128106421-128106443 GGGAACTCCAGTGCAGAAACTGG - Exonic
1076144566 10:128107153-128107175 GGGAACTCCAGTGCAGAAACTGG - Exonic
1076144659 10:128107879-128107901 GGGAACTCCAGTGCAGAAACTGG - Exonic
1076144706 10:128108245-128108267 GGGAACTCCAGTGCAGAAACTGG - Exonic
1081711425 11:45219022-45219044 GGGGGCTCCAGTGGGGACAGGGG - Intronic
1084511539 11:69607774-69607796 TGGAACTCCAGCTCAGCCAGAGG + Intergenic
1085383478 11:76141383-76141405 CGGAACTCCTGCGCGGCCGGCGG - Exonic
1088531480 11:110815432-110815454 GTGTACTCCAGCAGGGACAGTGG + Intergenic
1091265743 11:134269887-134269909 GGGGACTGCCGCGTGGACAGGGG + Intergenic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1097184203 12:57187969-57187991 AGGAAGGCCAGCTCGGACAGGGG + Intronic
1104108113 12:125682349-125682371 GGGAAATCCATGGGGGACAGGGG - Intergenic
1108063459 13:46554100-46554122 GGGAACTCCAGCGCGGACAGCGG + Intronic
1121277797 14:92679506-92679528 GGGCTCTCCAGCGAGGGCAGGGG + Intronic
1124657838 15:31523339-31523361 GGGACCTCCAGCGAGCCCAGCGG - Intronic
1134824265 16:17271960-17271982 GGGTATTCCAGAGGGGACAGAGG + Intronic
1136382216 16:29900987-29901009 GGGAGCTTCAGCGTGGAGAGAGG + Exonic
1140989964 16:80201255-80201277 GGGAACTCCAGCTAAGAGAGTGG + Intergenic
1141103244 16:81213072-81213094 GGACCCTCCAGCGGGGACAGTGG + Intergenic
1141116825 16:81315704-81315726 GCGAACTTCAGCGGGGACCGCGG - Intronic
1144708443 17:17385011-17385033 GGAAACACCAGTGCGGAGAGAGG + Intergenic
1146214930 17:30971376-30971398 GGGAACTGGAGCCCGGGCAGGGG - Exonic
1146651724 17:34611244-34611266 GGGAACTCAAGAGCAGGCAGGGG + Intronic
1149855429 17:60078709-60078731 GAGAACTACAGCGAGGGCAGTGG - Exonic
1150128172 17:62652363-62652385 GGGGACCCCATCGCCGACAGCGG - Intronic
1151314143 17:73311578-73311600 GGGAGTTCCAGCGTGGAGAGAGG + Intronic
1160129194 18:76209295-76209317 GTGAACTCCAGCGGGGAGCGGGG - Intergenic
1160196230 18:76758030-76758052 GAGACTTCCAGCACGGACAGCGG - Intergenic
1160548759 18:79679936-79679958 GGCACCTCCATCGCGGACAGAGG - Exonic
1161397572 19:4052606-4052628 GGGAACCCCAGGGCGGGCGGGGG + Intronic
1161607554 19:5223141-5223163 GGGAACTCCAGGGTGGCCAGGGG + Exonic
1163514648 19:17755610-17755632 GTGATCTCCAGCCTGGACAGTGG - Intronic
926113624 2:10197489-10197511 GGGAACTCCAGCAAGGCCTGGGG + Intronic
932431960 2:71681461-71681483 GGGCATTCCAGCTAGGACAGTGG + Intronic
932776043 2:74529049-74529071 GGGAACGCGAGTGGGGACAGGGG + Intronic
935880335 2:107558757-107558779 GAGCACTCCAGCGGGGACATGGG - Intergenic
938407478 2:131040494-131040516 GCGGGCGCCAGCGCGGACAGCGG + Intronic
938463517 2:131512527-131512549 GGGAACTTCAGGGATGACAGAGG + Intergenic
939112809 2:138028616-138028638 GGGAACTCCAAAGCTGAAAGAGG + Intergenic
942377702 2:175354230-175354252 GGGAAACCAAGCGTGGACAGAGG - Intergenic
942653781 2:178194507-178194529 GCGATCTCCAGCACCGACAGCGG - Exonic
1169214932 20:3787699-3787721 GGGAACTCCAGCATTGGCAGAGG + Intronic
1169278490 20:4248875-4248897 GGGGGCTCCAGCGCGGGCGGCGG - Exonic
1173865146 20:46308313-46308335 GGGAGCCCCGGCGCGGGCAGCGG + Exonic
1174806872 20:53611768-53611790 GGGAACTCCACCGCAGGAAGTGG - Intergenic
1181828902 22:25543162-25543184 GGGGACACCAGCACGGGCAGAGG - Intergenic
1184433036 22:44452803-44452825 GGGCACTGCAGGGTGGACAGGGG - Intergenic
951208318 3:19947253-19947275 CGGAACTCCAGCGCCGGCGGCGG + Exonic
954093859 3:48307243-48307265 GGGAACTCCTGAGGGGATAGAGG + Intronic
961738735 3:129018862-129018884 GGGAACTCCAGCGCCGAGTGGGG - Intronic
968561319 4:1284564-1284586 GGCAACTCCAGCGCAGAAAACGG + Intergenic
991565069 5:67996792-67996814 GGGAACTCAAGAGCCGACGGTGG + Intergenic
1000042257 5:157493478-157493500 TGGAACTCCTGGGTGGACAGCGG - Intronic
1003459655 6:6318432-6318454 GGGAACCCCAGTGGAGACAGAGG + Intronic
1013459128 6:110358352-110358374 GGGAACTCCCCCGCGGGCCGGGG + Intergenic
1016790790 6:148064945-148064967 TGGAATTCCAGCCCGGCCAGCGG - Intergenic
1018582346 6:165317870-165317892 GAGAACACCAGCGTGGACGGTGG + Intergenic
1019331131 7:461442-461464 GGGAACTGGAGCCAGGACAGTGG - Intergenic
1019345065 7:525638-525660 AGAAACTCCATCCCGGACAGAGG + Intergenic
1019408949 7:898360-898382 GGCAACTCCAGCCCGGGCAGGGG + Exonic
1021347944 7:19550503-19550525 GGGAACTACAGTGAGGACTGGGG - Intergenic
1031206398 7:118763934-118763956 AGGAACTCCAGCTCAGAGAGAGG + Intergenic
1034038649 7:147852089-147852111 GGGAACTCCAGTGTGAAGAGAGG + Intronic
1035245933 7:157561998-157562020 TGGGACTCCAGAGAGGACAGAGG + Intronic
1035567338 8:650285-650307 GGGAGACCCAGCGAGGACAGGGG - Intronic
1042867044 8:73365502-73365524 GGGAACTGCAGGGAGGACAACGG - Intergenic
1049287106 8:141781795-141781817 TGGAAGTCCAGCGGGGACAGTGG + Intergenic
1058581983 9:106468253-106468275 GGGAGCTCCAGCATGGACAAGGG - Intergenic
1061668751 9:132175924-132175946 GTGGACTCCAGTGCAGACAGAGG + Intronic
1061860733 9:133467530-133467552 GGAATCTCCACCGCGGAGAGGGG - Intronic
1185477637 X:424960-424982 GAAAACTCCAGTGGGGACAGAGG + Intergenic
1185528351 X:796947-796969 GGAAACCCTAGCGGGGACAGAGG + Intergenic
1201056852 Y:10002510-10002532 GGGAACTCAAGCTAGGACAAAGG - Intergenic
1202103838 Y:21340321-21340343 GGGAACTCAAGCTAGGACAAAGG + Intergenic