ID: 1108065126

View in Genome Browser
Species Human (GRCh38)
Location 13:46569636-46569658
Sequence CTGCCTAGCAGCAGATCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108065119_1108065126 16 Left 1108065119 13:46569597-46569619 CCTCCTGTGGCTCTCTCCTGCTT 0: 1
1: 0
2: 2
3: 57
4: 529
Right 1108065126 13:46569636-46569658 CTGCCTAGCAGCAGATCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 155
1108065115_1108065126 24 Left 1108065115 13:46569589-46569611 CCCAGACCCCTCCTGTGGCTCTC 0: 1
1: 0
2: 1
3: 51
4: 356
Right 1108065126 13:46569636-46569658 CTGCCTAGCAGCAGATCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 155
1108065117_1108065126 18 Left 1108065117 13:46569595-46569617 CCCCTCCTGTGGCTCTCTCCTGC 0: 1
1: 0
2: 3
3: 63
4: 699
Right 1108065126 13:46569636-46569658 CTGCCTAGCAGCAGATCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 155
1108065122_1108065126 0 Left 1108065122 13:46569613-46569635 CCTGCTTGCCCACCGAGGCTCAG 0: 1
1: 0
2: 1
3: 13
4: 189
Right 1108065126 13:46569636-46569658 CTGCCTAGCAGCAGATCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 155
1108065113_1108065126 29 Left 1108065113 13:46569584-46569606 CCTTGCCCAGACCCCTCCTGTGG 0: 1
1: 1
2: 6
3: 60
4: 509
Right 1108065126 13:46569636-46569658 CTGCCTAGCAGCAGATCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 155
1108065116_1108065126 23 Left 1108065116 13:46569590-46569612 CCAGACCCCTCCTGTGGCTCTCT 0: 1
1: 0
2: 4
3: 49
4: 411
Right 1108065126 13:46569636-46569658 CTGCCTAGCAGCAGATCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 155
1108065124_1108065126 -9 Left 1108065124 13:46569622-46569644 CCACCGAGGCTCAGCTGCCTAGC 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1108065126 13:46569636-46569658 CTGCCTAGCAGCAGATCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 155
1108065118_1108065126 17 Left 1108065118 13:46569596-46569618 CCCTCCTGTGGCTCTCTCCTGCT 0: 1
1: 0
2: 4
3: 69
4: 733
Right 1108065126 13:46569636-46569658 CTGCCTAGCAGCAGATCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 155
1108065123_1108065126 -8 Left 1108065123 13:46569621-46569643 CCCACCGAGGCTCAGCTGCCTAG 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1108065126 13:46569636-46569658 CTGCCTAGCAGCAGATCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 155
1108065120_1108065126 13 Left 1108065120 13:46569600-46569622 CCTGTGGCTCTCTCCTGCTTGCC 0: 1
1: 0
2: 2
3: 34
4: 431
Right 1108065126 13:46569636-46569658 CTGCCTAGCAGCAGATCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108065126 Original CRISPR CTGCCTAGCAGCAGATCCAC AGG Intronic
900017221 1:160586-160608 CTCCCTAGCAGGAAATCAACAGG + Intergenic
900047480 1:519182-519204 CTCCCTAGCAGGAAATCAACAGG + Intergenic
900069693 1:761050-761072 CTCCCTAGCAGGAAATCAACAGG + Intergenic
900079090 1:842263-842285 CTGCCTGGCAGCAGATCAAAGGG + Intergenic
900516404 1:3084257-3084279 CTGCCTGACACCAGATCCAGGGG - Intronic
903002007 1:20273216-20273238 CTGCCTTGCAGCCACTCCACTGG + Intergenic
903333286 1:22608513-22608535 CTGCTTTACAGCAGATCCTCAGG - Intergenic
905538628 1:38742844-38742866 CTGCCTGCCAGCCAATCCACTGG + Intergenic
907601694 1:55777710-55777732 TTGCCTAGTAGCTGATCCTCAGG - Intergenic
914357574 1:146899990-146900012 ATGCCTAGGAGTAGAACCACAGG + Intergenic
915948490 1:160171602-160171624 CTGCCTAGCAGCTTCTCCAAGGG + Exonic
920282853 1:204857471-204857493 CTGCCTAGCAACAGGTCAATTGG + Intronic
921955842 1:220982586-220982608 CTGCATAGCAGCAGACACAGTGG + Intergenic
924347239 1:243084041-243084063 CTCCCTAGCAGGAAATCAACAGG + Intergenic
1062817022 10:508304-508326 CAGCCTGGGCGCAGATCCACAGG + Intronic
1064650366 10:17502985-17503007 CTGTCTAGCAGCAGCTGAACGGG + Intergenic
1067723676 10:48750071-48750093 ATGCCCAGCAGCAGAGCCAGAGG - Intronic
1070569663 10:77631472-77631494 TTGCCAAGCTGCAGATCCCCTGG - Intronic
1070837707 10:79460760-79460782 CTGCCCAGCAGAAGCTCCACAGG + Intergenic
1071332259 10:84571617-84571639 CTGCCTGGCGCGAGATCCACTGG + Intergenic
1071363880 10:84878930-84878952 CTGCCTAGCAGCAGAGTGAATGG + Intergenic
1075663576 10:124215137-124215159 CTTCCAGGCAGCAAATCCACAGG - Intergenic
1076045045 10:127285717-127285739 CTGGCCAGCAGCAGCTCCATAGG - Intronic
1076264998 10:129102886-129102908 CTGCCCATCAACAGATCCTCAGG + Intergenic
1076973822 11:155814-155836 CTCCCTAGCAGGAAATCAACAGG + Intergenic
1077014671 11:394276-394298 CTGCATGGCGGCAGGTCCACCGG - Exonic
1084648278 11:70473546-70473568 GTGTCTAGTGGCAGATCCACTGG + Intronic
1085178378 11:74510845-74510867 CTGCCAGGCAGCATATCCCCTGG + Intronic
1090964177 11:131583927-131583949 GTGCCTAGCTGCAGATCCTTGGG - Intronic
1091289547 11:134430116-134430138 AATCCTAGCAGCAGAACCACGGG - Intergenic
1091960021 12:4685841-4685863 CTCCCTAGAAGCAAATGCACAGG - Intronic
1092125314 12:6071306-6071328 CTTCATTGCTGCAGATCCACTGG + Exonic
1093864306 12:24206598-24206620 CTTTTTATCAGCAGATCCACTGG + Intergenic
1095766035 12:45896732-45896754 GAGCCTAACAGCAGATCAACAGG + Intronic
1098728590 12:74001976-74001998 CTGCCAACCAGGAGATCCAATGG + Intergenic
1100373572 12:93991735-93991757 CAGTCTAGCAGCAGGTTCACTGG - Intergenic
1104360891 12:128132168-128132190 CTGTGTAGCAGGAGAGCCACAGG - Intergenic
1104482754 12:129122437-129122459 GTGTCTAGCAGCAAATTCACAGG - Intronic
1104766019 12:131330851-131330873 CTCCTTAGCTGCAGATCTACAGG - Intergenic
1105403314 13:20114199-20114221 CTGCCATGCAGCAGACCCAGAGG + Intergenic
1108065126 13:46569636-46569658 CTGCCTAGCAGCAGATCCACAGG + Intronic
1119083789 14:71721620-71721642 CTGAGTAGCAGCTCATCCACAGG - Intronic
1119340966 14:73877146-73877168 CTGCCCAGCCACAGATCCACAGG - Exonic
1121641744 14:95489244-95489266 CTCCCCAGCAGCACATCCATGGG + Intergenic
1121849319 14:97205461-97205483 CAGCCTAGAAGCAGAGCCAGTGG + Intergenic
1124145832 15:27124381-27124403 GAGCCCAGCAGCAGAGCCACTGG - Intronic
1130604417 15:85302380-85302402 CTGCCTGGCAGCAGAGTGACAGG - Intergenic
1131465383 15:92650828-92650850 CTGCCAAGTAGCAGACCCAGGGG + Intronic
1135424455 16:22325434-22325456 TTGCCCAGCAGCAGAGCCTCAGG + Intronic
1136074312 16:27806416-27806438 TTCCCCAGCAGCAGACCCACAGG + Intronic
1139976611 16:70817305-70817327 ATGCCTAGGAGTAGAACCACAGG - Intronic
1141451016 16:84102222-84102244 CTCCCAAGCAGCTGATCTACAGG - Intronic
1141626083 16:85261820-85261842 CTGCCCAGCTGCAGAAACACAGG - Intergenic
1142308533 16:89299244-89299266 CTGCCTGGGAGGAGATCTACAGG + Intronic
1142446441 16:90141871-90141893 CTCCCTAGCAGGAAATCAACAGG - Intergenic
1142461064 17:93592-93614 CTCCCTAGCAGGAAATCAACAGG + Intergenic
1144168770 17:12638181-12638203 CTGCCTTGCTGCAGATAAACAGG - Intergenic
1144800246 17:17921405-17921427 CTCTCTAGAAGCAGAGCCACTGG + Intronic
1145123588 17:20282009-20282031 CAGCCCAACAGCAGTTCCACTGG - Intronic
1145763580 17:27442665-27442687 CTGCCTTTCAGCATCTCCACAGG - Intergenic
1146746865 17:35338620-35338642 CTGACTAGAATCAGAACCACAGG - Intergenic
1146905958 17:36618046-36618068 CTGCCCAGCTGCTGCTCCACTGG - Intergenic
1148643466 17:49205418-49205440 CTCTCTAGCAGCAGATCCTAAGG + Intronic
1149544601 17:57494039-57494061 CTACATAGCAGAAGCTCCACTGG + Intronic
1150217848 17:63480224-63480246 CCAGCTAGCTGCAGATCCACGGG + Intergenic
1151320941 17:73352074-73352096 CTGCAGAGCAGCAGAGACACAGG - Intronic
1151584586 17:75001468-75001490 CTGCCCAGCAGAAGATCCATGGG + Exonic
1152273712 17:79341530-79341552 CTGCCTAGCCTCAGCTCCCCTGG - Intronic
1152288038 17:79423735-79423757 CTGCCCAGCAGCGACTCCACTGG - Intronic
1152485222 17:80586634-80586656 CCGCCTGGCAGCTGAACCACAGG - Intronic
1155651621 18:28150405-28150427 CTGCCTTAGGGCAGATCCACTGG - Intronic
1160650766 19:225959-225981 CTCCCTAGCAGGAAATCAACAGG + Intergenic
1162589067 19:11578873-11578895 GTGCCCAGCTGCAGATCCGCAGG + Exonic
1163224102 19:15943274-15943296 CTGCCTAACAGCACATACAAAGG - Intergenic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1167271204 19:48507495-48507517 CTGCCTACCAGGGGAGCCACTGG + Intronic
928552036 2:32382194-32382216 CTTCCTAGTCCCAGATCCACGGG - Intronic
932083006 2:68732416-68732438 CGGCCCAGCAGCATCTCCACGGG - Intronic
934592093 2:95562818-95562840 CTGCCTAGCAGCTGTTGCTCTGG - Intergenic
937064846 2:119010210-119010232 CTTCCCACCACCAGATCCACTGG - Intergenic
937337792 2:121072427-121072449 CTGCCCAGCAGCAGTGCCAGGGG - Intergenic
938208203 2:129441656-129441678 CTACCTAGCACCAAATCCATGGG - Intergenic
938548116 2:132353248-132353270 CTGCCCTGCAGCAGCTGCACGGG + Intergenic
940855318 2:158724723-158724745 CTGCCAGGCATCAGAGCCACAGG - Intergenic
942274368 2:174308620-174308642 CTGCTTATCAGCACATGCACGGG - Intergenic
947447431 2:230174815-230174837 CTGCCGAGCAGCAGTGACACTGG + Intronic
1171876985 20:30586020-30586042 CTGCCCTGCAGCAGCTGCACGGG + Intergenic
1173023294 20:39285745-39285767 CTGCCTAGAAGCAGAGCCTGAGG + Intergenic
1173221297 20:41135144-41135166 CTGCCTCACAGGAGATCCACTGG - Intergenic
1173975548 20:47183992-47184014 CTGCCTGGCAGCAAATCCCAAGG + Intronic
1175313139 20:58025540-58025562 CAGCCCAGCAGCAGAGCAACTGG + Intergenic
1175972709 20:62694928-62694950 CTGCCTGGCATCAGATGCAGTGG + Intergenic
1179088148 21:38238482-38238504 CAGCCCAGCAGCAGACCCTCAGG - Intronic
1179174808 21:39000674-39000696 CTGCTTTGCAGCAGAGCCAGGGG - Intergenic
1179552208 21:42150585-42150607 CTGCCTGGCAACAGTTCCAGGGG + Intergenic
1181774603 22:25150307-25150329 CTGCCTGGCAGCAGAACCCCTGG + Intronic
1184677455 22:46051454-46051476 CTGCCTGTCAGCAGATGCACAGG - Exonic
1185106202 22:48871370-48871392 CTCCCTGGCAGCACATCCTCTGG + Intergenic
950679536 3:14575501-14575523 CAGCATAGCAGCCGGTCCACAGG + Intergenic
952966528 3:38624329-38624351 ATGCTTAGCAGCAGATCCGTGGG - Intronic
953849012 3:46450914-46450936 CTGCCAGGCAGCAGCTGCACGGG - Intronic
956788385 3:72661382-72661404 CTGCCTGGCAGCAGGGCCCCCGG - Intergenic
961341749 3:126227790-126227812 CTGCATGGCAGCAGCTCTACAGG - Intergenic
961415637 3:126754681-126754703 GTTCCTAGCAGCAGTTACACTGG - Intronic
961435987 3:126916924-126916946 CTGCCAAGGAGAAGATGCACTGG + Intronic
961681832 3:128604558-128604580 CTGCCTGGCTGCAGAAACACAGG - Intergenic
964928154 3:161982366-161982388 ATGTCTAGCAGCAGATCCTCGGG - Intergenic
968367066 3:198194028-198194050 CTCCCTAGCAGGAAATCAACAGG - Intergenic
970014133 4:11493700-11493722 CTGCCTAGCAGCAAAGACAATGG - Intergenic
974672180 4:65046578-65046600 ATGCCAAGCAGCAGAGCCACAGG + Intergenic
979178201 4:117691829-117691851 CTTCCTGGTGGCAGATCCACAGG + Intergenic
979255476 4:118603635-118603657 CTCCCTAGCAGGAAATCAACAGG - Intergenic
979332864 4:119436877-119436899 CTCCCTAGCAGGAAATCAACAGG + Intergenic
979702456 4:123684804-123684826 CTGCCTGGCAGCCCATCCTCTGG + Intergenic
982058245 4:151575415-151575437 CTTCCTAGCAGCAGCAACACTGG - Intronic
986019018 5:3783691-3783713 CTGCTTCTCAGCAGACCCACTGG - Intergenic
992596771 5:78355203-78355225 CTTCCAAGCAGCAGAACCAAGGG - Intergenic
993588306 5:89760403-89760425 CTGCCCAGCAGGATTTCCACTGG + Intergenic
996840161 5:127838966-127838988 ATGCCAAGTAGCAGCTCCACAGG + Intergenic
1002726291 5:181299226-181299248 CTCCCTAGCAGGAAATCAACAGG - Intergenic
1008538325 6:52525124-52525146 CTGCCTAGCTGCAGGTCCTGGGG - Intronic
1011293562 6:85803278-85803300 CTCCCAAGTAGCAGAACCACAGG - Intergenic
1014252542 6:119129266-119129288 CTGCCCAGCCACAGATCCTCAGG - Intronic
1019317751 7:397817-397839 CTCCTTTGCAGCAGAGCCACGGG + Intergenic
1019619074 7:1980760-1980782 CTGAATAGCAACAGATGCACAGG + Intronic
1021575418 7:22101715-22101737 CTGGCTCACAGTAGATCCACTGG - Intergenic
1022199909 7:28106519-28106541 CTGCCAAGCAGAAGAAACACAGG + Intronic
1022252805 7:28625631-28625653 TTGCCTTGCTGAAGATCCACAGG + Intronic
1023861207 7:44218559-44218581 CTGGCCAGCAGCAGATGCACTGG - Exonic
1024071172 7:45786750-45786772 CTCCCTAGCAGGAAATCAACAGG - Intergenic
1024954510 7:54902551-54902573 CTGAGGAGCAGCAAATCCACAGG + Intergenic
1025135109 7:56404999-56405021 CTCCCTAGCAGGAAATCAACAGG + Intergenic
1026040964 7:66867613-66867635 CTCCCTAGCAGGAAATCAACAGG - Intergenic
1028034375 7:85961404-85961426 CTGTCTAGCAGTAGAGCTACAGG + Intergenic
1030069232 7:105684557-105684579 CTGCCAAGCTGCAAATCCACAGG + Intronic
1032121151 7:129157813-129157835 CTGCATAGCAGCAGATGAATTGG + Intronic
1034150799 7:148914169-148914191 CTGCCTGGCAGCAGAAGCAGTGG + Intergenic
1035353891 7:158265680-158265702 CTGCCCAGCAGCACAGCCCCGGG + Intronic
1035436795 7:158865464-158865486 CTGCCCAGCACCAGCTCCCCAGG - Intronic
1035526540 8:317420-317442 CTGCCTGGCAGCAGATCAAAGGG - Intergenic
1042193352 8:66210385-66210407 CTGCAGAGCAGAAGAACCACTGG - Intergenic
1045502677 8:102755532-102755554 TTGCTGAGCAGCAGAACCACTGG - Intergenic
1045505225 8:102773497-102773519 CTGCCCAGCAGGGGCTCCACAGG + Intergenic
1049545214 8:143227686-143227708 CTGGCCAGCAGCAGGACCACCGG + Intergenic
1049694964 8:143978782-143978804 CGGCATAGCAGGAGCTCCACCGG + Intronic
1051802767 9:20955067-20955089 CTTCCTATCAGCAGTCCCACCGG - Intronic
1052872641 9:33523670-33523692 CTGCCCTGCAGCAGCTGCACGGG + Intergenic
1053752319 9:41269183-41269205 CTGCCCTGCAGCAGCTGCACGGG - Intergenic
1053752769 9:41273440-41273462 CTGCCCTGCAGCAGCTGCACGGG - Intergenic
1053801301 9:41766054-41766076 CTGCGTAGCTACAGAGCCACAGG - Intergenic
1054189731 9:61978208-61978230 CTGCGTAGCTACAGAGCCACAGG - Intergenic
1054257846 9:62833515-62833537 CTGCCCTGCAGCAGCTGCACGGG - Intergenic
1054258294 9:62837792-62837814 CTGCCCTGCAGCAGCTGCACGGG - Intergenic
1054333476 9:63782249-63782271 CTGCCCTGCAGCAGCTGCACGGG + Intergenic
1054648784 9:67610384-67610406 CTGCGTAGCTACAGAGCCACAGG + Intergenic
1056035397 9:82599770-82599792 GTGCTTGGCAACAGATCCACAGG + Intergenic
1056505799 9:87257184-87257206 CTGCCTGCCTGCAGAGCCACTGG + Intergenic
1059240117 9:112797092-112797114 CTGCCTAGCAGCAGATGTGAAGG - Intronic
1061478266 9:130883678-130883700 CTGGCTGGCAGGAGAGCCACAGG - Intronic
1061482150 9:130902638-130902660 CTGCCTAGCAGCCTCTCCTCGGG - Exonic
1062751422 9:138256872-138256894 CTCCCTAGCAGGAAATCAACAGG - Intergenic
1202800479 9_KI270719v1_random:170583-170605 CTGCCCTGCAGCAGCTGCACGGG + Intergenic
1202800925 9_KI270719v1_random:174865-174887 CTGCCCTGCAGCAGCTGCACGGG + Intergenic
1186718580 X:12278962-12278984 CTGCTTAGCAGCATATATACGGG - Intronic
1189299462 X:39942115-39942137 GTGCCTAGCAGGAGATACAATGG + Intergenic
1189420136 X:40849974-40849996 CTGCCTAGCTCTAGATCCAGAGG + Intergenic
1197023239 X:121716533-121716555 CTGCCTTGCTGCAGATCCCAGGG + Intergenic
1199664668 X:150087262-150087284 CTACCTAGAAACAGACCCACAGG + Intergenic