ID: 1108065850

View in Genome Browser
Species Human (GRCh38)
Location 13:46577029-46577051
Sequence CTGCTGGCCTGAAAGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 407}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108065850_1108065855 -1 Left 1108065850 13:46577029-46577051 CCTTTTTTCTTTCAGGCCAGCAG 0: 1
1: 0
2: 1
3: 45
4: 407
Right 1108065855 13:46577051-46577073 GGAAAAGGTCTCTGACTTGAGGG 0: 1
1: 0
2: 1
3: 24
4: 218
1108065850_1108065857 3 Left 1108065850 13:46577029-46577051 CCTTTTTTCTTTCAGGCCAGCAG 0: 1
1: 0
2: 1
3: 45
4: 407
Right 1108065857 13:46577055-46577077 AAGGTCTCTGACTTGAGGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 151
1108065850_1108065856 2 Left 1108065850 13:46577029-46577051 CCTTTTTTCTTTCAGGCCAGCAG 0: 1
1: 0
2: 1
3: 45
4: 407
Right 1108065856 13:46577054-46577076 AAAGGTCTCTGACTTGAGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 178
1108065850_1108065854 -2 Left 1108065850 13:46577029-46577051 CCTTTTTTCTTTCAGGCCAGCAG 0: 1
1: 0
2: 1
3: 45
4: 407
Right 1108065854 13:46577050-46577072 AGGAAAAGGTCTCTGACTTGAGG 0: 1
1: 0
2: 1
3: 19
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108065850 Original CRISPR CTGCTGGCCTGAAAGAAAAA AGG (reversed) Intronic
902314632 1:15608870-15608892 CTGCTGGCGGGAATGTAAAATGG - Intergenic
903388902 1:22949837-22949859 CTGCTGGCTAGAATGTAAAAGGG + Intergenic
903702753 1:25262818-25262840 CAGGTGGCTTGAAACAAAAACGG - Intronic
905605193 1:39291852-39291874 CTGCTGGCTTGGTAGGAAAATGG - Intronic
906120419 1:43386434-43386456 GTGCTGGCCTTAAATACAAAAGG + Intronic
906974716 1:50557828-50557850 CTTCTTGCCTGAAATTAAAAAGG - Intronic
907287865 1:53393499-53393521 CTGCTGGCCACAGACAAAAACGG + Intergenic
910003571 1:82366828-82366850 CAGCTAGCCTGACAGAATAATGG - Intergenic
910136183 1:83972672-83972694 TTGCTGGCAGGAATGAAAAATGG - Intronic
910168920 1:84357453-84357475 CTGCTGGCCTGAGAGAGCGATGG - Intronic
910603965 1:89063044-89063066 AAGCTGGCTGGAAAGAAAAAGGG - Exonic
910904027 1:92154382-92154404 CTGCTGGCAGGAATGCAAAATGG - Intergenic
911153602 1:94618615-94618637 CTGCTGGCTTGAGAAATAAAGGG + Intergenic
911782167 1:101895037-101895059 CAGCTGGCCTGAAAGTAAGCAGG - Intronic
912658526 1:111508430-111508452 CTGCTGCCGAGAAAGAAAACGGG + Intronic
912795960 1:112693851-112693873 CTGCTGGTATGAAAGGAAAGAGG + Intronic
913478898 1:119265708-119265730 TTGATGGCCTGGAAGATAAAAGG + Intergenic
913671920 1:121105049-121105071 CTGGTGACCAGAAAGAACAAGGG - Intergenic
914023695 1:143892494-143892516 CTGGTGACCAGAAAGAACAAGGG - Intergenic
914662171 1:149800441-149800463 CTGGTGACCAGAAAGAACAAGGG - Intronic
915058618 1:153160494-153160516 CTGTTGGCATGAATGAAGAATGG - Intergenic
916293941 1:163196308-163196330 CTGCTGGCCAGAGAGAAAAGGGG - Intronic
916471987 1:165132924-165132946 ATGCTGGGATGGAAGAAAAAAGG + Intergenic
917285841 1:173420542-173420564 CTACTGGCCAGGAAAAAAAAAGG - Intergenic
917471502 1:175329937-175329959 CTGCTGGCCAGGGAGAAGAAGGG - Intronic
918678104 1:187315531-187315553 CTGCTGGCAAGAATGCAAAATGG - Intergenic
918742030 1:188143882-188143904 CTTTTGATCTGAAAGAAAAAGGG - Intergenic
919410382 1:197234963-197234985 CTGCTGGCCTGACAGAATGATGG + Intergenic
919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG + Intronic
920086956 1:203424416-203424438 ATGCTGGCCTGGAAGACAGAAGG - Intergenic
920690577 1:208143473-208143495 ATGCTGACCTCAAAGAAAAGAGG + Intronic
921104385 1:211961111-211961133 CTGATGTCCTGAAAGAGATAGGG + Intronic
921187581 1:212683546-212683568 CTGCTGGGCTGAAGGAAGGAAGG - Intergenic
922578365 1:226678676-226678698 GTCCTGGCCAGAGAGAAAAAGGG + Intronic
922844053 1:228668964-228668986 ATGGTGGCCTGAATGAAAAGGGG + Intergenic
923037441 1:230294126-230294148 CTGCAGGCCAGAAAGAAAGAAGG + Intergenic
924189206 1:241531805-241531827 CATCTGGGCTGAAAAAAAAAAGG + Intergenic
1063001653 10:1929899-1929921 CTGCTAGAATGAAGGAAAAATGG + Intergenic
1063083957 10:2797631-2797653 CTGTTGGCATGAATGTAAAATGG + Intergenic
1063257873 10:4349197-4349219 CTGCTGGGATTAGAGAAAAATGG - Intergenic
1063494279 10:6492190-6492212 GTTCTGGACTGAAAGAGAAAAGG - Intronic
1064178588 10:13096614-13096636 TTGCTGGGCTGAAAAATAAATGG - Intronic
1064304717 10:14154891-14154913 TTGTTGGTCTGAAAGAAATATGG + Intronic
1064332999 10:14411285-14411307 CTGCTTTCTTGGAAGAAAAAAGG - Intronic
1064578957 10:16774056-16774078 CTGATGAACAGAAAGAAAAATGG + Intronic
1065040303 10:21687315-21687337 ATGCTTCCCTGAAATAAAAAAGG - Intronic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1065357510 10:24856729-24856751 CTGCTAGCCTGAGAGAAGTAAGG - Intronic
1065490559 10:26277758-26277780 CTGGAGGCCTGGAAGGAAAATGG + Intronic
1065838052 10:29677173-29677195 CTGCTGAGCTGAAGGCAAAAAGG - Intronic
1065900314 10:30200453-30200475 CTGGTGGCCTTAAAGAAGTAGGG - Intergenic
1067290893 10:44939212-44939234 CTGCTGGTGGGAAAGTAAAATGG - Intergenic
1067688393 10:48481720-48481742 CAGCTGGCGGGAAAGTAAAATGG - Intronic
1069190350 10:65479763-65479785 CTGCCAGCATGAAAGAACAAAGG - Intergenic
1071227634 10:83549160-83549182 CTGCTGGTCAGAATGTAAAATGG - Intergenic
1072353051 10:94577275-94577297 CAGAAGGCATGAAAGAAAAAAGG - Intronic
1072455284 10:95570088-95570110 TTGCTGGCGTGAATGTAAAATGG - Intergenic
1072519408 10:96217409-96217431 TTGCTGGCAGGAATGAAAAATGG - Intronic
1073003226 10:100300983-100301005 CTGCTGGTCTGAGAAATAAAGGG + Intronic
1073016528 10:100404358-100404380 CTCCAGGCCTGAAGGAAACAGGG + Intergenic
1073056250 10:100704653-100704675 CTGCTGGTAAAAAAGAAAAAGGG + Intergenic
1073707373 10:106000240-106000262 CTGCTGGCCGTAAATTAAAATGG - Intergenic
1073939394 10:108677698-108677720 CTGATGTCCTTAAAAAAAAACGG + Intergenic
1074094865 10:110302744-110302766 CTGGTGTCCTGAAACACAAAAGG + Intronic
1074765664 10:116698452-116698474 CTGCTGGTGGGAAAGTAAAATGG - Intronic
1075189249 10:120291280-120291302 CTGGTGACCTTAAAGAAAAATGG + Intergenic
1075348060 10:121698920-121698942 CTGCTGGGCTAAAAGTAACAAGG - Intergenic
1076039740 10:127235729-127235751 TTGCTGGTCTGAAGGCAAAATGG - Intronic
1077434390 11:2531778-2531800 CAGCTGGCATGACAGATAAAGGG - Intronic
1079191416 11:18280431-18280453 CTGCTGGCAGGAAAGTAAAATGG + Intronic
1079635818 11:22739213-22739235 CTTCTGGCCTGGAAGACAAATGG + Intronic
1079711508 11:23688905-23688927 CTGCTTGCCTTGAAGAAAGAAGG - Intergenic
1080115019 11:28612212-28612234 CTGCTGGCCTGATAGAATGTTGG - Intergenic
1080158822 11:29145895-29145917 TTGCTGGCCTGAAAGAACTCTGG - Intergenic
1080890274 11:36403078-36403100 CTGCTGGCTTGCAAGAAAGCGGG + Intronic
1081357351 11:42127669-42127691 TTGCTGGTGGGAAAGAAAAATGG + Intergenic
1083078089 11:60062453-60062475 TGGATGGCCTGAAAGAAGAAAGG - Exonic
1084204169 11:67581935-67581957 CGGCTGGCCTGAGAAATAAAGGG - Intergenic
1086239711 11:84675081-84675103 CTGCAGGCCTGAAATAAACCTGG + Intronic
1088095397 11:106094568-106094590 TTGCTTTCCTGAAAGATAAAAGG - Exonic
1088259676 11:107932208-107932230 CTACTTGCCTGAAATAAAAAGGG + Intronic
1088556016 11:111061783-111061805 TTGCTGGCAAGAACGAAAAATGG + Intergenic
1088609755 11:111565805-111565827 CTGGTGTCCTCAAAAAAAAAAGG + Intergenic
1089022881 11:115235226-115235248 CTGCTTTTCTGAAAAAAAAAGGG + Intronic
1090663031 11:128895276-128895298 CTGCTGCTCAGAAAGGAAAATGG + Intronic
1090980500 11:131716467-131716489 CTGCTGGTGGGAATGAAAAATGG - Intronic
1091621234 12:2090838-2090860 CTGTTGGCGGGAAAGTAAAATGG - Intronic
1092041964 12:5393157-5393179 CAGCTGCCCTGAAAGAGAACTGG + Intergenic
1092109177 12:5946689-5946711 CTGCTGGAGGGAAAGAAGAAAGG - Intergenic
1092609639 12:10158156-10158178 CTGCTGGTAGGAATGAAAAATGG + Intergenic
1093278542 12:17160179-17160201 CAACTGACCTGAAAAAAAAAAGG + Intergenic
1095926179 12:47581874-47581896 CTGCAGGCTTGAGAGAAGAAAGG + Intergenic
1096166855 12:49433013-49433035 CTGCTGGCAAGAATGTAAAATGG - Intronic
1097351785 12:58556794-58556816 CTGCAGGCCTGATAGAGCAACGG - Intronic
1097408407 12:59220810-59220832 CTGCTGCAGAGAAAGAAAAAAGG + Intergenic
1097728961 12:63106187-63106209 CTGGTGGCCTGAAAGTCAAGTGG - Intergenic
1097738282 12:63208210-63208232 CTGTTGGACAGAAAGATAAAGGG - Intergenic
1098891522 12:76014184-76014206 CTCCTGCCCTGAAAGGAATAGGG + Intergenic
1099117808 12:78649228-78649250 CAGCTGGCCTGAGAAATAAACGG - Intergenic
1100141801 12:91627962-91627984 CTGCTGGTGGGAAAGCAAAATGG - Intergenic
1100667698 12:96772421-96772443 CTGCTGGCTTGGAAGATAAAGGG - Intronic
1101306983 12:103538246-103538268 CTGCTAGCTGGGAAGAAAAATGG + Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101765218 12:107691691-107691713 CTTCTTGTCTGAAAGAAAAGAGG - Intronic
1101881362 12:108628374-108628396 CTGCTGCCCTGAAGGCAAATTGG - Intronic
1101924085 12:108956834-108956856 CTGCTGGCCTAAGAGAGCAATGG + Intronic
1102090461 12:110183041-110183063 CTGATGGCCTGACAGAATAGTGG - Intronic
1102318886 12:111913746-111913768 CTGCTGGTGTGAATGTAAAATGG + Intergenic
1103001281 12:117387091-117387113 ATGCTGGCCAAAAAGCAAAATGG - Intronic
1103084402 12:118051234-118051256 CTGCTGGTGGGAAAGTAAAATGG + Intronic
1103352928 12:120298023-120298045 CTGCAGCCTTGAAAAAAAAAGGG + Intergenic
1104167194 12:126244006-126244028 CTGCTGGCGGGAATGTAAAATGG + Intergenic
1104648376 12:130513079-130513101 CTGCTGGCCAGAAACCCAAAAGG - Intronic
1105774070 13:23640093-23640115 GTGCTGACCTGCAAGAGAAAGGG + Intronic
1106014524 13:25855761-25855783 CTGCTGGTGGGAAAGTAAAACGG - Intronic
1106995561 13:35476364-35476386 CGGCTGGGCTCAAAGATAAAAGG - Exonic
1107223210 13:38012094-38012116 CTGCTGATTTGAAAGAGAAAAGG + Intergenic
1107935113 13:45340365-45340387 CTGTTGGCCGGAACAAAAAATGG + Intronic
1108065850 13:46577029-46577051 CTGCTGGCCTGAAAGAAAAAAGG - Intronic
1108120067 13:47175954-47175976 CTTCTTGCCTGAAAGATAGAAGG - Intergenic
1108553968 13:51574759-51574781 CTGCTGGCAGGAATGTAAAATGG - Intergenic
1109452887 13:62541302-62541324 CTGATGGTCAGATAGAAAAATGG + Intergenic
1110002610 13:70224126-70224148 CTGCAGGCTTGAAAGGAAGATGG + Intergenic
1111413538 13:87909705-87909727 ATGATGTCCTTAAAGAAAAAGGG + Intergenic
1112498438 13:99923671-99923693 CTACTGGCCAGAATGTAAAATGG + Intergenic
1112506378 13:99978735-99978757 CTGATGGCCTGAAAGAAGGAAGG + Intergenic
1112787601 13:102968374-102968396 CAGCATGCCTGACAGAAAAAAGG + Intergenic
1115541982 14:34429361-34429383 CTTCTGGGCAGATAGAAAAAGGG - Intronic
1115676204 14:35677902-35677924 CTGACGCCCTAAAAGAAAAAAGG + Intronic
1116783342 14:49261112-49261134 ATTCTGGCCTGAAAGAAAAGAGG + Intergenic
1118069771 14:62233119-62233141 CTGCTGGAGGGAAAGTAAAATGG - Intergenic
1118865638 14:69701502-69701524 CTGCTGCCCTGAACAAAAGAGGG + Intronic
1119678974 14:76577707-76577729 CTTCTGGTCTGAAGGACAAATGG - Intergenic
1120668861 14:87340766-87340788 CTTCCTGCCTGAAATAAAAATGG - Intergenic
1123898355 15:24850798-24850820 CTCCTGTCCTAAAAGCAAAAGGG + Intronic
1124040307 15:26095893-26095915 CTGCTGCCCTGAGAGAGCAACGG + Intergenic
1124508348 15:30298761-30298783 CTGCTGGTGTGAATGAAAAATGG - Intergenic
1124627925 15:31319947-31319969 TTGCTGGCTTTAAAGACAAAGGG - Intergenic
1124735209 15:32239895-32239917 CTGCTGGTGTGAATGAAAAATGG + Intergenic
1125140142 15:36396354-36396376 CTGTTGCCCTGAAAGAACACAGG - Intergenic
1125631966 15:41154541-41154563 CTGCTGCCCTGAAAGGAAACTGG - Intergenic
1125774584 15:42200598-42200620 CTGCTGGCAGGAATGTAAAATGG + Intronic
1126187334 15:45842960-45842982 CTCCTAGCCTTAAAAAAAAAGGG + Intergenic
1126205082 15:46036275-46036297 CTGCTGGCCTCAAAAAATATTGG - Intergenic
1126263459 15:46723388-46723410 CTGCTGGTGTGAATGTAAAATGG - Intergenic
1126289487 15:47057540-47057562 CAGCTGGCCTGATAGAATGATGG - Intergenic
1126730715 15:51679794-51679816 TTGCTTGCCCAAAAGAAAAAGGG - Intergenic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1126913382 15:53438232-53438254 CTGCTGCCCAGGAAGAAAAGGGG + Intergenic
1127862812 15:63008600-63008622 CTCCTGGGCTGAAGGATAAAAGG + Intergenic
1128056328 15:64702729-64702751 CGGTGGGGCTGAAAGAAAAAAGG + Intronic
1129757668 15:78108412-78108434 CTGCTGGCCTGACAGACCCATGG - Intronic
1130315542 15:82792214-82792236 CTGCTGGCAGGAATGTAAAATGG - Intronic
1130372021 15:83293101-83293123 CTACTATCCTTAAAGAAAAATGG - Intergenic
1131454124 15:92570174-92570196 CTTTTGGCCTGAAAGAAGAATGG - Intergenic
1131517062 15:93086565-93086587 CTGATGGCCAGAAAGCAGAAGGG - Intronic
1131939162 15:97541723-97541745 CTGCTTGCCTGACAGAGGAATGG - Intergenic
1132007500 15:98242413-98242435 CTGGTGGCCTTAAAGGAAGAGGG - Intergenic
1132278913 15:100595553-100595575 CTGCTGGTGAGAATGAAAAACGG + Intronic
1132325643 15:100967510-100967532 CTGCTCTGCAGAAAGAAAAAAGG - Intronic
1132380826 15:101365449-101365471 TTGCTGGCCGGAATGTAAAAGGG + Intronic
1133102736 16:3489020-3489042 ATGCTGGCCCCAAAGAAAACTGG - Intergenic
1133103505 16:3493150-3493172 ATGCTGGCCCCAAAGAAAACTGG + Intergenic
1133300954 16:4782549-4782571 CTGCTGGAGGGAAAGTAAAATGG - Intronic
1133736911 16:8622596-8622618 ATGCTGGGAAGAAAGAAAAAAGG - Intronic
1135242705 16:20822985-20823007 CTGCTGGTGGGAAAGTAAAATGG - Intronic
1135582968 16:23643543-23643565 TTCCTGGCATAAAAGAAAAAAGG - Intronic
1138703223 16:58886964-58886986 CTGCTGGTGTGAATGTAAAATGG + Intergenic
1140754440 16:78055092-78055114 CTGAGGTCCTGAAAGAAAATAGG + Intronic
1140894964 16:79316845-79316867 ATGCTGGACTGAAAGAAAGAGGG + Intergenic
1141545655 16:84766476-84766498 CTGCTGGGCTGAAGGAGCAAAGG - Intronic
1141599827 16:85118894-85118916 CTGCTGGCCTGGAGGAAGATGGG - Intergenic
1142155805 16:88532444-88532466 CTGCTGTCCCGAGAGACAAAAGG + Intronic
1142694405 17:1625602-1625624 TTTCTGGCCTGAAAGAAAACTGG + Intronic
1143697977 17:8634389-8634411 CTGCTGGCAGGAACGGAAAATGG + Intergenic
1144103228 17:11962371-11962393 CTGATGGCCTCAAGGAAAGAAGG - Intronic
1144407516 17:14966516-14966538 CACCTGGCCTGAAGGAAGAAAGG - Intergenic
1146974959 17:37103271-37103293 CTGTTCTCCTGAAAGAAAGAAGG + Intronic
1147222878 17:38949616-38949638 TTGCTGGCGGGAAAGTAAAATGG - Intronic
1148044449 17:44734174-44734196 CTGCTGAACTGAAGGACAAATGG + Intronic
1149144888 17:53478544-53478566 CTGGTGGCTTGAAGGAACAAAGG + Intergenic
1149977151 17:61277886-61277908 CTGCTGGCAGGAATGTAAAATGG + Intronic
1150535532 17:66035487-66035509 CTGCTGGTGAGAATGAAAAATGG + Intronic
1150543288 17:66125917-66125939 CTGATGGTTTAAAAGAAAAATGG - Intronic
1150655274 17:67035070-67035092 CTGCTGGCTTCAAAGAAGGAAGG + Intergenic
1151407807 17:73900816-73900838 CCGCTGGCCTGAAAGAGGAATGG + Intergenic
1151799001 17:76366460-76366482 CACCTGCCCTGAAAGAAAGAGGG + Intronic
1153312522 18:3691078-3691100 CACCTGGCCTGAGAAAAAAAGGG - Intronic
1153499433 18:5732958-5732980 CTGCTGGCATAAAAGAAATGAGG + Intergenic
1153987498 18:10366642-10366664 CTGATGCCCTAAAACAAAAAAGG + Intergenic
1154366806 18:13717871-13717893 CTGCTGGCCTCAAGGAAACAAGG + Intronic
1154953518 18:21232673-21232695 CTGCTGGCAGGAATGTAAAATGG - Intergenic
1155981158 18:32181338-32181360 CTGCTGGTAGGAAAGCAAAATGG - Intronic
1156035176 18:32758466-32758488 CTGCTGGTGTGAATGTAAAATGG + Intronic
1156565648 18:38186509-38186531 CTGCTGAACTTAAAGAAATATGG - Intergenic
1156800067 18:41099890-41099912 CTGCTGGCCTGGAAACAGAATGG - Intergenic
1157041514 18:44045140-44045162 ATGCAGGCTTGAAGGAAAAATGG - Intergenic
1157822477 18:50783529-50783551 TTGCTGGCAGGAATGAAAAATGG + Intergenic
1157922554 18:51728218-51728240 CTGCTGGTCTGGAAGAGAGAAGG + Intergenic
1159330721 18:66991154-66991176 ATACTGGCCTGAAAGAATGACGG - Intergenic
1159956962 18:74525564-74525586 CTGCTGGCGGGAATGTAAAATGG - Intergenic
1162785977 19:13035116-13035138 CCTCTGGCCTGGAAGAAACAGGG + Intronic
1163299567 19:16435361-16435383 CTGCTGTTCTGAAAGACATAGGG + Intronic
1163865185 19:19767633-19767655 AAGCTGAGCTGAAAGAAAAACGG + Intergenic
1164492742 19:28729438-28729460 CTGCTGGCCTTCAAGAAAGCAGG - Intergenic
925891858 2:8440721-8440743 CTGCTGGCCTGATAAAACCATGG + Intergenic
926409088 2:12582964-12582986 CTGCAGGCCTGAAAGAACACTGG + Intergenic
926521079 2:13914683-13914705 CTGCTGGTCTGAATGTAAAATGG + Intergenic
927629427 2:24759266-24759288 CTGAGGGCTTAAAAGAAAAAAGG + Intronic
927969524 2:27296586-27296608 CTGCTGGCTGGAAAGAAGACGGG - Intronic
928049983 2:27981955-27981977 CTGCTGGTGTGAATGCAAAATGG - Intronic
928365436 2:30697040-30697062 GTGCTGGCGGGAATGAAAAAGGG - Intergenic
928455460 2:31416671-31416693 ATTCTGCCCTGAAAGAAAGAAGG + Intergenic
928862943 2:35881692-35881714 CTGCTGTCATGAGAGATAAATGG + Intergenic
929633782 2:43494330-43494352 CAGCAGGAATGAAAGAAAAAGGG - Intronic
932193798 2:69765325-69765347 CTGCTGGTAAGAAAGTAAAATGG - Intronic
932513614 2:72321969-72321991 CTGCTGGCAGGAATGGAAAATGG + Intronic
932965811 2:76473484-76473506 ATTCTGGCCCGAATGAAAAAAGG + Intergenic
933210457 2:79561533-79561555 CTGCTGGAGGGAAAGAAAAATGG - Intronic
933934526 2:87191184-87191206 CTGCTGGTGGGAAAGTAAAATGG - Intergenic
934098952 2:88633458-88633480 TTGCTGGTCTGAAGGTAAAATGG + Intergenic
934665583 2:96167674-96167696 CTGCTGGTGTGAACGTAAAATGG + Intergenic
935727105 2:106032955-106032977 CTGCTGGTGGGAAAGAGAAATGG + Intergenic
936358617 2:111774712-111774734 CTGCTGGTGGGAAAGTAAAATGG + Intronic
936654085 2:114464210-114464232 CTGCTGGTCAGAATGCAAAATGG - Intronic
936733126 2:115407531-115407553 CTGCTGGCCTGAAGGAGAGAAGG + Intronic
938711218 2:133977707-133977729 CAGCTGGCCTGAAACAAGATTGG + Intergenic
938872850 2:135499187-135499209 CGGCTGGCCTGAGAAATAAAGGG - Intronic
939848337 2:147274644-147274666 TTGTTGGCATGAGAGAAAAAAGG - Intergenic
941713939 2:168744370-168744392 CTGATAGCCTGAAAAAAAAAAGG - Intronic
941901983 2:170687578-170687600 CTGCTATTCTGAAAGTAAAATGG - Intergenic
942508497 2:176669998-176670020 CTGCTCTCCTGAAAGTAAATGGG - Intergenic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
942999024 2:182301226-182301248 CTGCTGGCCTGACAGAATGTTGG + Intronic
943329136 2:186537802-186537824 CTGCTGGTGAGAATGAAAAATGG - Intergenic
943729372 2:191285724-191285746 CAGCAGGCATGAAAGAAACAAGG + Intronic
944400370 2:199319407-199319429 CTGCTGGGATAAAAGAAAAAGGG - Intronic
944734477 2:202549807-202549829 CTGCTGGCCAGAATGTAAAATGG - Intronic
944756001 2:202762286-202762308 CTGTTTACCTGAAAGAAAATAGG + Intronic
945265908 2:207891187-207891209 CTGCTGGTCAGAATAAAAAACGG + Intronic
945627278 2:212226194-212226216 CTGTTGGCCAGTAAGAAAATGGG + Intronic
946173331 2:217908227-217908249 CTGCTGCCCTGAGTGAAGAAAGG - Intronic
946817264 2:223592023-223592045 GTGAAGGCCTGATAGAAAAATGG + Intergenic
948534587 2:238636449-238636471 CTGCAGGCCTGAAACAAAACAGG - Intergenic
948534743 2:238637513-238637535 CTGCTGGCCTGGAAGAAGGAAGG + Intergenic
1168922942 20:1556068-1556090 CTTCTGGCCTTAAAGAAGCAAGG - Intronic
1169425345 20:5492580-5492602 GTGCTGCCCTTAAAGAGAAACGG - Intergenic
1170897975 20:20433472-20433494 CTGCTAGCCTGTGAGAAAACAGG + Intronic
1171162911 20:22944743-22944765 CTGCTTGGCTGAAGGAAATAAGG + Intergenic
1171233658 20:23507829-23507851 CTGCAGGCTTGAAAGACAGAAGG + Intergenic
1171800872 20:29615761-29615783 CAGCTGGCCTGATAGAATGATGG - Intergenic
1171843227 20:30240931-30240953 CAGCTGGCCTGATAGAATGATGG + Intergenic
1171953310 20:31440539-31440561 CTGCTGACCTAAATGACAAAGGG + Exonic
1172131508 20:32659182-32659204 CAGCTGCCCTGAAAGAGAAGGGG - Intergenic
1172184298 20:33021700-33021722 CTGCAGGCGAGAAAGAAGAAAGG - Intronic
1172324095 20:34020769-34020791 TTGCTGACCTGTAAGAAAGAAGG + Intronic
1174084407 20:47995626-47995648 CTGCTGGCAGGAATGCAAAATGG - Intergenic
1175360822 20:58411129-58411151 CTGCTGGTGGGAATGAAAAACGG - Intronic
1175504042 20:59469581-59469603 CTGCAGTCCTCACAGAAAAATGG - Intergenic
1176137618 20:63531058-63531080 CAGCTGGCCTGATTGAAAATTGG + Intronic
1177826083 21:26084654-26084676 CTTCTGGCCTGAAACAAATGTGG + Intronic
1178143469 21:29710892-29710914 CTGCTGGAAGGAAAGAAGAAAGG - Intronic
1178341704 21:31791060-31791082 CTGCTGACCTGAAATTAAGAAGG - Intergenic
1178360587 21:31946125-31946147 CTGCTCGCCAGGAAGAAATACGG + Exonic
1180178242 21:46100995-46101017 CTGTTGGCAGGAAAGCAAAATGG - Intronic
1180648558 22:17359936-17359958 CTGTTGGCCTTAAAGGAAAAAGG + Intronic
1181259878 22:21589924-21589946 CACCTGGCCAGAAAGAAGAATGG - Intronic
1181692513 22:24572003-24572025 CAGATAACCTGAAAGAAAAAAGG - Exonic
1183978652 22:41527273-41527295 CCGCTTGCCTGACAGAAACATGG + Exonic
949455503 3:4234009-4234031 CTCCTGGCCTGAAAGAATTATGG + Intronic
949507622 3:4741970-4741992 CTGTTGGCATTAAAGAAAGAGGG + Intronic
949557546 3:5169491-5169513 CTGCTGGCAGGAAGGCAAAATGG - Intronic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
951232428 3:20194868-20194890 CTGCTGGTGGGAAAGTAAAATGG - Intergenic
951907321 3:27717926-27717948 CTGTTGGGCTGAAAGAACAGAGG + Intronic
952052245 3:29398393-29398415 CTGATGACCAGAGAGAAAAAGGG - Intronic
952629337 3:35445911-35445933 ATTCTGAGCTGAAAGAAAAATGG + Intergenic
953293848 3:41693218-41693240 TTGCTGGTGAGAAAGAAAAATGG + Intronic
955474865 3:59326353-59326375 CTGCTGGCCTGAAACCAATGTGG + Intergenic
955802868 3:62704251-62704273 CTCCTGGCCTGAATGACAGAAGG + Intronic
956111525 3:65874652-65874674 CTGCTGGTGTGAATGTAAAATGG + Intronic
956657862 3:71569432-71569454 GTGCTGCCCTCAAAGAAAGAAGG + Intronic
957559109 3:81798697-81798719 CTCCAGCCCTGAAAGAAAAGGGG - Intergenic
958494276 3:94823296-94823318 ATTCTAGCCTGAAAGAACAAAGG + Intergenic
959267148 3:104156986-104157008 CTGCTTGCCTGATAGAACACTGG - Intergenic
959770368 3:110088061-110088083 CTGCTGATTTCAAAGAAAAAGGG - Intergenic
960699845 3:120429000-120429022 CTGCTGGCCAGGAAGAAAGTGGG + Intronic
961842620 3:129729165-129729187 CTGCTGGTAGGAAAGGAAAATGG - Intronic
962293975 3:134163603-134163625 ATGCTGCACTAAAAGAAAAAAGG - Intronic
962294079 3:134164833-134164855 CTGCTGGCAGGAATGTAAAATGG - Intronic
962936417 3:140085236-140085258 TTGCTGCACTGAAAGAAAGATGG + Intronic
963047013 3:141109996-141110018 CTGTTGGCCTGAGGGAGAAATGG + Intronic
964170263 3:153761531-153761553 CTGCTGGCCTGGAAGCAACTGGG - Intergenic
964295347 3:155227039-155227061 CTTCTGGCCTGAAAAAAGAAAGG + Intergenic
964367969 3:155969923-155969945 CTGCTGGCTTGGAAAATAAAGGG - Intergenic
964946055 3:162225017-162225039 ATCCAGGACTGAAAGAAAAAAGG + Intergenic
965032911 3:163396467-163396489 CTTTGGGCCTGAAAGAACAAAGG - Intergenic
965802725 3:172511227-172511249 GTGGTGGCCTGAAACAAAGAAGG + Intronic
966083681 3:176039365-176039387 CTGTTGGCGCAAAAGAAAAATGG - Intergenic
966218423 3:177526593-177526615 CTGATGGCAGGAAAGAAGAATGG + Intergenic
966559613 3:181305450-181305472 CTGCTGGCCTGCAATATACATGG - Intergenic
967189569 3:186973767-186973789 GTGCTGCACTGAAAGAAAACGGG + Intronic
968746044 4:2360836-2360858 CTGCGGGCCCGACAGATAAATGG + Intronic
969986434 4:11216256-11216278 TTGCTGGCAAGAAAGGAAAATGG + Intergenic
970781570 4:19744106-19744128 CTGCTGTTCAGAGAGAAAAATGG - Intergenic
971229972 4:24793786-24793808 CTGCTGGACTGAAAGTATAGTGG + Intronic
971752269 4:30666124-30666146 CTGAAAGCCTGCAAGAAAAAGGG - Intergenic
973005102 4:44995943-44995965 TTGATGGCCTGAAGGTAAAAGGG - Intergenic
974248218 4:59350279-59350301 TTGGTGAACTGAAAGAAAAAGGG + Intergenic
974615049 4:64269708-64269730 TTCCTGGCCTGATGGAAAAAGGG - Intergenic
975853166 4:78594483-78594505 CTGCTGATATGAAAGCAAAATGG - Intronic
977003782 4:91538968-91538990 CAGCTGGGCTGACAGAACAAGGG - Intronic
977444610 4:97114908-97114930 CTTCAGGGCAGAAAGAAAAAAGG + Intergenic
977578813 4:98702718-98702740 CTGCTGGTGGGAAAGTAAAATGG + Intergenic
977966773 4:103160143-103160165 CTACTTGTCTAAAAGAAAAATGG - Intronic
980181994 4:129412691-129412713 CTGCTGAACTAAAAGAAGAAGGG - Intergenic
981860152 4:149345207-149345229 ATGCTGGAATGAAAAAAAAAGGG + Intergenic
983512384 4:168622519-168622541 CTTCTGGGCTGAAAGAAAAAAGG - Intronic
984115049 4:175669823-175669845 CTGCTGTCCTTATAAAAAAAGGG + Intronic
984447846 4:179859500-179859522 CTTCTGGCATGCCAGAAAAATGG - Intergenic
985426894 4:189839985-189840007 CTGCTTCCCTGAAAGAAATACGG + Intergenic
986603671 5:9499927-9499949 GTTCTGCCCTGAAAAAAAAAAGG + Intronic
987269072 5:16286416-16286438 TTTCTGACCTGAAAGAACAATGG - Intergenic
988094846 5:26592496-26592518 CTGCTAGCCAGAATGAAAATGGG - Intergenic
990659285 5:57995242-57995264 CTGCAGACTTGTAAGAAAAATGG + Intergenic
990942447 5:61216145-61216167 CTCCTGGCTTGAAAGAAATAAGG - Intergenic
991918194 5:71626355-71626377 CTACTGGCCTGAAAAACTAATGG - Intronic
993620544 5:90162728-90162750 CTCCTGGCCTCAAAGGAAAGAGG + Intergenic
995475851 5:112547533-112547555 CAGCTGGCCTGAAAGAATGGTGG + Intergenic
995514536 5:112940904-112940926 CTGCAGGGCTGCAAGAAAAAGGG + Intergenic
997449042 5:133967452-133967474 GTCTTGGCCTGAAAGAAAAATGG + Intronic
997543889 5:134689217-134689239 CTGCTGGTCAGAATGTAAAATGG + Intronic
998788871 5:145744236-145744258 CTGCTGGTCTGCAGGAGAAAAGG - Intronic
1000246494 5:159452745-159452767 CTGCTGGGCTGAACACAAAAAGG + Intergenic
1000773535 5:165388008-165388030 CTGCTGGTCAGAATGTAAAACGG + Intergenic
1001067134 5:168544795-168544817 CTGCTGGAGTGAATGTAAAATGG + Intergenic
1001218332 5:169876539-169876561 CTGATGGCCTGGAAGAACAAGGG + Intronic
1001307162 5:170583724-170583746 CTGCTGAGCTGATGGAAAAAGGG + Intronic
1001440083 5:171736050-171736072 CTGCTGGGGTGAAATGAAAATGG - Intergenic
1002170129 5:177370308-177370330 CTGCTGGCATGAAATGATAAGGG - Intronic
1002438421 5:179249834-179249856 ATGCTGGCCTCATAGAAAGATGG - Intronic
1002511212 5:179719209-179719231 CTGCTGGTGGGAAAGTAAAATGG - Intronic
1004802484 6:19165349-19165371 TTGCTGGCAGGAATGAAAAATGG + Intergenic
1004911249 6:20287216-20287238 CTGCTGGTGGGAAAGTAAAATGG + Intergenic
1004948513 6:20642419-20642441 CTATTAGCCTGATAGAAAAATGG + Intronic
1004963208 6:20816132-20816154 CTGTTGTCCTTAAAAAAAAAAGG - Intronic
1005868348 6:29954696-29954718 CTGATAGCCTGAAGGAAACAGGG + Intergenic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1006150349 6:31983698-31983720 CTGCTTTCCTGAAGGAAATAAGG + Intronic
1006156650 6:32016436-32016458 CTGCTTTCCTGAAGGAAATAAGG + Intronic
1006727241 6:36208545-36208567 CTACTGGCCTGCTAGAAAAGGGG - Intronic
1007146171 6:39634951-39634973 CTGCTGTCCTGATTGGAAAAGGG + Exonic
1008949310 6:57138183-57138205 TTGCTGGCGGGAAAGTAAAATGG - Intronic
1009850867 6:69196550-69196572 CTGGTGTCCTTATAGAAAAAAGG - Intronic
1010070537 6:71739023-71739045 CTGCTGGCCTGATAGAGTGATGG + Intergenic
1010751595 6:79621661-79621683 CTGCTAGCAAGAAAGACAAAGGG - Intergenic
1011590276 6:88964770-88964792 CTGATGGCCTTAAAGGAAACTGG - Intergenic
1011834614 6:91416352-91416374 GTGATTGACTGAAAGAAAAAAGG + Intergenic
1012372384 6:98523399-98523421 CTGCAGGCATGGAAGTAAAATGG + Intergenic
1012429860 6:99153055-99153077 CTGCTGGCCTTGAAGAAACAAGG + Intergenic
1012614284 6:101257378-101257400 CTGCTGGTGAGAATGAAAAATGG + Intergenic
1013670175 6:112393259-112393281 CTGCTGGTCTGAAAGATATCAGG + Intergenic
1014041548 6:116832630-116832652 ATGCTGCCCTGAAAAACAAAAGG - Intergenic
1015632594 6:135246451-135246473 CTGCTGGCCTGAATTGAGAAAGG - Intergenic
1016525557 6:144998149-144998171 CTTCTGAGCTTAAAGAAAAAAGG + Intergenic
1017361962 6:153584128-153584150 CATCTGGCATGAATGAAAAATGG - Intergenic
1017832132 6:158140231-158140253 CTGGTGGCCAGAAAGACTAAGGG + Intronic
1018801255 6:167224006-167224028 CTGCTGGCCTCACACAGAAAGGG - Intergenic
1020219531 7:6224603-6224625 TTGCTGGCGTGAATGGAAAATGG + Intronic
1020434695 7:8150474-8150496 CTGCTTTCCTGACAGGAAAATGG + Intronic
1020445707 7:8265028-8265050 CTGCTGGTGGGAAAGTAAAATGG + Intergenic
1020999826 7:15315012-15315034 CTGATAGCCCGCAAGAAAAATGG + Intronic
1022006332 7:26269025-26269047 CTGCTGGCGGGAATGTAAAATGG - Intergenic
1023909718 7:44544967-44544989 CTGATGGCAAGAAAGACAAAGGG - Intergenic
1024127085 7:46310270-46310292 GTGGTGGCCAAAAAGAAAAAAGG - Intergenic
1024448595 7:49512360-49512382 CTGCTGGCCTTGAAGAAATAAGG - Intergenic
1024491387 7:49989719-49989741 CTGCAGACCAGAAGGAAAAAAGG + Intronic
1024548801 7:50543377-50543399 CTACTGGCTTCAGAGAAAAAGGG + Intronic
1027421438 7:78020562-78020584 CTGATGGGCTCAAAAAAAAAAGG + Intronic
1027689516 7:81325502-81325524 TTGCTGGCAGGAATGAAAAATGG - Intergenic
1028467091 7:91164654-91164676 CAGCTGGCCCGAAATACAAATGG + Intronic
1031046060 7:116889179-116889201 CAACATGCCTGAAAGAAAAATGG + Intronic
1031141590 7:117948923-117948945 GTGCTGGCCTGGAAGAGCAATGG + Intergenic
1031360875 7:120846926-120846948 CTTCTGGTCAGAAAGAACAAAGG + Intronic
1032388532 7:131540793-131540815 CTCCTGGCCTAAAACAAACAAGG + Intronic
1033170345 7:139078325-139078347 TTGCTGGTGGGAAAGAAAAATGG + Intronic
1033170823 7:139082389-139082411 CTGCTGGCAGAAATGAAAAATGG + Intronic
1034558031 7:151862292-151862314 CTACTGGCCAGAAAAAAAAGGGG - Intronic
1034637199 7:152576821-152576843 CTCCTGCCCTTAAGGAAAAAGGG + Intergenic
1036158400 8:6363764-6363786 CAGCTGGCCTGAGAAATAAAGGG - Intergenic
1039293123 8:36120662-36120684 CTGCTGGCCTGCAAGACATCAGG + Intergenic
1039831515 8:41219007-41219029 CAGCTGGCCTGATATAACAATGG + Intergenic
1040745897 8:50642173-50642195 CTTCTGGTGTGAAATAAAAATGG - Intronic
1040840143 8:51776445-51776467 CGGCTGGCCTGAGAAATAAATGG - Intronic
1041093234 8:54324267-54324289 TTGCTGGCAGGAAAGCAAAATGG + Intergenic
1041548421 8:59073514-59073536 GTGCTGGCCTGAAAGTAAATTGG - Intronic
1042719641 8:71813482-71813504 CACCCGGCATGAAAGAAAAAGGG - Intergenic
1043149857 8:76701964-76701986 TTGCTGGCCTGAAGGAAATGAGG - Intronic
1043340153 8:79228842-79228864 CTACTGGTCTGCAAGAAACATGG - Intergenic
1043784451 8:84380491-84380513 CTCCTGGCCTATAAGAATAATGG + Intronic
1044051500 8:87511428-87511450 CTGCCTGCCTGATAGATAAATGG - Intronic
1044486444 8:92759970-92759992 CTGTGGGCCTGAAAGAAATTTGG - Intergenic
1044899612 8:96930214-96930236 CTGCTGGACGAAAAGAAACATGG - Intronic
1046082787 8:109392500-109392522 CTGTTGGCTTTAAAAAAAAATGG - Intronic
1047420302 8:124702534-124702556 CTGAAGGAATGAAAGAAAAAAGG + Intronic
1047730035 8:127720337-127720359 CTGCTGGCATGAATATAAAATGG + Intergenic
1048431244 8:134373404-134373426 CTGATGGATTGCAAGAAAAAAGG + Intergenic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1049543452 8:143218823-143218845 CTGCTGGGCTGGATGAGAAAGGG - Intergenic
1050058171 9:1677538-1677560 CTGCTGGCCTGATAGAGCATTGG - Intergenic
1050182605 9:2936261-2936283 CTGCTGGCTTGAAAGATTCAGGG - Intergenic
1050521985 9:6510640-6510662 CTGCTGGCAGGAAGGTAAAATGG - Intergenic
1051506374 9:17831644-17831666 ATGGTGGCCTGAATGAAAACAGG - Intergenic
1051841747 9:21405683-21405705 CTGCTGGCCTGCAACATAAAAGG + Intergenic
1051862636 9:21644201-21644223 CAGCTGGCCTGATAGAACACAGG + Intergenic
1052104912 9:24501663-24501685 CTGATTTCCTGAAAAAAAAATGG + Intergenic
1054727277 9:68665126-68665148 CTGCTGGCCTGACAGAATGGAGG + Intergenic
1055159216 9:73104657-73104679 CTGCTGGCTTCAAAGATAAAGGG + Intergenic
1055983159 9:82026269-82026291 CTGCTGGTGGGAATGAAAAATGG - Intergenic
1056887090 9:90453556-90453578 CTCCTGGCTTGCATGAAAAAGGG + Intergenic
1057925532 9:99144238-99144260 CTGCTGGCAGGAATGTAAAATGG - Intronic
1059388711 9:113985354-113985376 CTGCTGGCCAACAAGAAAAGGGG - Intronic
1059804788 9:117787039-117787061 CTGCTGGCCTGAGATAGGAAGGG + Intergenic
1060560960 9:124542957-124542979 CTGCTGGCAAGTAAGAACAACGG + Intronic
1060698953 9:125734098-125734120 CTGCTGGTGGGAATGAAAAATGG + Intergenic
1061507733 9:131041013-131041035 CTGCTGGACAGAAAGAAGGAAGG + Intronic
1061993483 9:134172659-134172681 CTGAGGGCCTGAAAGAAGGAGGG + Intergenic
1186108192 X:6227871-6227893 CTGTTAACCAGAAAGAAAAAGGG - Intronic
1186665698 X:11714822-11714844 CTCTTGGGCTGAAAGAACAAAGG + Intergenic
1187592109 X:20728701-20728723 CTGCTGGCAAGAATGTAAAATGG + Intergenic
1187858750 X:23661921-23661943 TTGCTGGTGTGAATGAAAAATGG + Intergenic
1188273268 X:28169977-28169999 CTTCTTGGCTTAAAGAAAAAAGG - Intergenic
1189171963 X:38917692-38917714 ATCCAGGCCTGGAAGAAAAATGG + Intergenic
1189268649 X:39735440-39735462 CCACTGGCCAGAAAGAAGAAGGG + Intergenic
1189273371 X:39767411-39767433 CTGCATGCCTGAAAGAAGGAGGG - Intergenic
1189445985 X:41082132-41082154 TTGCTGGCATGAATGTAAAATGG - Intergenic
1189645848 X:43130526-43130548 CTGCTGTCCTGACAGGAATAAGG - Intergenic
1189914581 X:45844318-45844340 CTGCTGGCTGGAATGTAAAATGG + Intergenic
1190113981 X:47613754-47613776 CTGCTGGCCTGATGGAATGATGG + Intronic
1190159841 X:48023474-48023496 CTGCTGGTTGGAAAGTAAAATGG - Intronic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1191666860 X:63712164-63712186 CTGCTGGCAGGAATGTAAAATGG + Intronic
1192604759 X:72504797-72504819 CTGCTGGCGAGAAAGTAAAATGG - Intronic
1194212620 X:91087306-91087328 CTGCTGGTCTGAAAGACATAAGG - Intergenic
1194788796 X:98119469-98119491 TTGCTGCCCTGAAAGGAAGAAGG + Intergenic
1195053145 X:101116781-101116803 CTGCTGGCAGGAATGAAAAATGG - Intronic
1195579569 X:106485714-106485736 CTGCTGATCTGAAAGATTAAGGG + Intergenic
1195779682 X:108448072-108448094 CTGCTGGCCTTTAACCAAAAGGG + Intronic
1196114358 X:111983014-111983036 CAGCTGGCTTGAAAGAACAGTGG - Intronic
1197333803 X:125186710-125186732 CTGCAGGCTTTAAAGAAACATGG - Intergenic
1197379592 X:125722847-125722869 CTGCTGGCAGGAATGTAAAATGG - Intergenic
1198156825 X:133968868-133968890 TTTCTGCCCTGAATGAAAAATGG - Intronic
1200041915 X:153376757-153376779 CTGCTGGCTTTAAAGACAGAGGG + Intergenic
1200109888 X:153735367-153735389 CTGCTGGCGGGAAGGTAAAATGG - Intronic