ID: 1108065953

View in Genome Browser
Species Human (GRCh38)
Location 13:46577851-46577873
Sequence GTAAATGACAGCAGTCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 289}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108065953_1108065957 1 Left 1108065953 13:46577851-46577873 CCCTCCAGACTGCTGTCATTTAC 0: 1
1: 0
2: 0
3: 18
4: 289
Right 1108065957 13:46577875-46577897 ATTGCTAGAGAACAAGAGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 234
1108065953_1108065958 14 Left 1108065953 13:46577851-46577873 CCCTCCAGACTGCTGTCATTTAC 0: 1
1: 0
2: 0
3: 18
4: 289
Right 1108065958 13:46577888-46577910 AAGAGCTGGGAGCCTCTCCTTGG 0: 1
1: 0
2: 2
3: 22
4: 242
1108065953_1108065960 28 Left 1108065953 13:46577851-46577873 CCCTCCAGACTGCTGTCATTTAC 0: 1
1: 0
2: 0
3: 18
4: 289
Right 1108065960 13:46577902-46577924 TCTCCTTGGTTCTGCTCCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 353
1108065953_1108065956 0 Left 1108065953 13:46577851-46577873 CCCTCCAGACTGCTGTCATTTAC 0: 1
1: 0
2: 0
3: 18
4: 289
Right 1108065956 13:46577874-46577896 AATTGCTAGAGAACAAGAGCTGG 0: 1
1: 0
2: 0
3: 25
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108065953 Original CRISPR GTAAATGACAGCAGTCTGGA GGG (reversed) Intronic