ID: 1108065958

View in Genome Browser
Species Human (GRCh38)
Location 13:46577888-46577910
Sequence AAGAGCTGGGAGCCTCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 242}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108065952_1108065958 17 Left 1108065952 13:46577848-46577870 CCACCCTCCAGACTGCTGTCATT 0: 1
1: 0
2: 2
3: 62
4: 689
Right 1108065958 13:46577888-46577910 AAGAGCTGGGAGCCTCTCCTTGG 0: 1
1: 0
2: 2
3: 22
4: 242
1108065953_1108065958 14 Left 1108065953 13:46577851-46577873 CCCTCCAGACTGCTGTCATTTAC 0: 1
1: 0
2: 0
3: 18
4: 289
Right 1108065958 13:46577888-46577910 AAGAGCTGGGAGCCTCTCCTTGG 0: 1
1: 0
2: 2
3: 22
4: 242
1108065951_1108065958 18 Left 1108065951 13:46577847-46577869 CCCACCCTCCAGACTGCTGTCAT 0: 1
1: 0
2: 1
3: 19
4: 241
Right 1108065958 13:46577888-46577910 AAGAGCTGGGAGCCTCTCCTTGG 0: 1
1: 0
2: 2
3: 22
4: 242
1108065954_1108065958 13 Left 1108065954 13:46577852-46577874 CCTCCAGACTGCTGTCATTTACA 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1108065958 13:46577888-46577910 AAGAGCTGGGAGCCTCTCCTTGG 0: 1
1: 0
2: 2
3: 22
4: 242
1108065955_1108065958 10 Left 1108065955 13:46577855-46577877 CCAGACTGCTGTCATTTACAATT 0: 1
1: 0
2: 0
3: 14
4: 203
Right 1108065958 13:46577888-46577910 AAGAGCTGGGAGCCTCTCCTTGG 0: 1
1: 0
2: 2
3: 22
4: 242
1108065950_1108065958 19 Left 1108065950 13:46577846-46577868 CCCCACCCTCCAGACTGCTGTCA 0: 1
1: 0
2: 3
3: 36
4: 361
Right 1108065958 13:46577888-46577910 AAGAGCTGGGAGCCTCTCCTTGG 0: 1
1: 0
2: 2
3: 22
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108065958 Original CRISPR AAGAGCTGGGAGCCTCTCCT TGG Intronic