ID: 1108065960

View in Genome Browser
Species Human (GRCh38)
Location 13:46577902-46577924
Sequence TCTCCTTGGTTCTGCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108065953_1108065960 28 Left 1108065953 13:46577851-46577873 CCCTCCAGACTGCTGTCATTTAC 0: 1
1: 0
2: 0
3: 18
4: 289
Right 1108065960 13:46577902-46577924 TCTCCTTGGTTCTGCTCCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 353
1108065955_1108065960 24 Left 1108065955 13:46577855-46577877 CCAGACTGCTGTCATTTACAATT 0: 1
1: 0
2: 0
3: 14
4: 203
Right 1108065960 13:46577902-46577924 TCTCCTTGGTTCTGCTCCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 353
1108065954_1108065960 27 Left 1108065954 13:46577852-46577874 CCTCCAGACTGCTGTCATTTACA 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1108065960 13:46577902-46577924 TCTCCTTGGTTCTGCTCCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108065960 Original CRISPR TCTCCTTGGTTCTGCTCCTG TGG Intronic