ID: 1108067652

View in Genome Browser
Species Human (GRCh38)
Location 13:46595019-46595041
Sequence CTATAAACTCAGAAGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 374}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108067652_1108067654 16 Left 1108067652 13:46595019-46595041 CCTAGCTTCTTCTGAGTTTATAG 0: 1
1: 0
2: 3
3: 30
4: 374
Right 1108067654 13:46595058-46595080 AATACCATGATGATCATTCTGGG 0: 1
1: 1
2: 0
3: 13
4: 147
1108067652_1108067655 17 Left 1108067652 13:46595019-46595041 CCTAGCTTCTTCTGAGTTTATAG 0: 1
1: 0
2: 3
3: 30
4: 374
Right 1108067655 13:46595059-46595081 ATACCATGATGATCATTCTGGGG 0: 1
1: 0
2: 0
3: 18
4: 106
1108067652_1108067653 15 Left 1108067652 13:46595019-46595041 CCTAGCTTCTTCTGAGTTTATAG 0: 1
1: 0
2: 3
3: 30
4: 374
Right 1108067653 13:46595057-46595079 TAATACCATGATGATCATTCTGG 0: 1
1: 0
2: 2
3: 7
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108067652 Original CRISPR CTATAAACTCAGAAGAAGCT AGG (reversed) Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901827620 1:11872658-11872680 CTATAGCCCCAGAAGCAGCTCGG - Intergenic
905465749 1:38151794-38151816 CTATAAAGACGGAGGAAGCTGGG - Intergenic
906881739 1:49598782-49598804 CTAAAAACTCTCAATAAGCTGGG - Intronic
907071078 1:51535405-51535427 CTTTAAAGACAGAAGAAACTAGG - Intergenic
907234112 1:53029232-53029254 TTTTAAACTTAGAAGAATCTTGG + Intronic
907487304 1:54786909-54786931 CTCTAAACTGAGAAGGAGCCTGG - Intronic
907668674 1:56455136-56455158 CTAAAAACACAAAATAAGCTGGG + Intergenic
908367429 1:63440662-63440684 CTATAAATTAATAAGCAGCTGGG + Intergenic
908769632 1:67584316-67584338 CTTTATAATCAAAAGAAGCTTGG - Intergenic
911166837 1:94731755-94731777 CTATGAACAGAGAAGAAACTGGG - Intergenic
911170118 1:94762426-94762448 CTAAAAACTCTGAATAAACTAGG + Intergenic
911991046 1:104697077-104697099 CTAAAAACTCTCAATAAGCTAGG + Intergenic
912930546 1:113955591-113955613 GAATAAAATCAAAAGAAGCTCGG + Exonic
913020687 1:114786506-114786528 CTAAAAACTCTCAATAAGCTAGG - Intergenic
914459059 1:147865558-147865580 CTAAAAACTCTGAATAAACTAGG + Intergenic
916264565 1:162877677-162877699 CTCTAAATTCAGAAAATGCTGGG + Intergenic
916308609 1:163368932-163368954 CTCAAAACTCAGAAGAAATTAGG + Intergenic
916404957 1:164489153-164489175 CTAAAAACTGAGAAGGAGCCGGG + Intergenic
916924298 1:169501644-169501666 CTAAAAACTCTGAATAAACTAGG + Intergenic
918502265 1:185210496-185210518 CTAAAAACTCTCAAGAAACTAGG + Intronic
918945507 1:191059470-191059492 CTAAAAACTCTGAATAAACTAGG - Intergenic
918999285 1:191808444-191808466 CTATAAACTCAAAAAAAAGTGGG + Intergenic
920109867 1:203580233-203580255 CTAAAAACTCAAAATTAGCTGGG - Intergenic
922129581 1:222763942-222763964 CTAAAAACTCTGAATAAACTAGG + Intergenic
922371833 1:224918995-224919017 CTCAAAATTCAGAAGAAGCCAGG - Intronic
922666886 1:227477860-227477882 CTAAAAACTCTGAATAAACTAGG + Intergenic
923578816 1:235187377-235187399 CTATAAAACAAGAATAAGCTGGG - Intronic
924748006 1:246856182-246856204 CTATGAACTCAGTAGAGGCAAGG + Intronic
924868237 1:248009975-248009997 CTAAAAACTCTCAATAAGCTAGG + Intronic
924925840 1:248679188-248679210 GTATAAAATTAGGAGAAGCTGGG + Intergenic
1064007528 10:11710326-11710348 CTAAAAATTCAGAATTAGCTGGG - Intergenic
1065742626 10:28810994-28811016 CTATAAACTCCCAGGAAGCAAGG - Intergenic
1067300467 10:45003497-45003519 CAGTAGACTCAGAAGAAGCTTGG + Exonic
1070155769 10:73834211-73834233 CTTAAAACCCAGTAGAAGCTGGG - Intronic
1072407128 10:95165774-95165796 CTAAAAACTCTCAATAAGCTGGG + Intergenic
1073359019 10:102882337-102882359 CAAAAAAATCAGAAGAAGCCAGG - Intronic
1073563022 10:104512938-104512960 ATATTAATTCAGAGGAAGCTGGG - Intergenic
1073965987 10:108990583-108990605 CTATAAATTCATGAGAAGCAAGG - Intergenic
1075553601 10:123412661-123412683 CCATAAGCTAAGAAGAAGCCAGG - Intergenic
1076783581 10:132737981-132738003 CTATAAAATGAGAAGATTCTTGG - Intronic
1078392523 11:10948447-10948469 CTAAAAACTCACAATAAACTAGG - Intergenic
1078780345 11:14432881-14432903 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1080503325 11:32890144-32890166 CAATAAACTCAGAAGGAAGTGGG - Intergenic
1081082695 11:38762847-38762869 CTAAAAACTCTGAATAAACTAGG - Intergenic
1081124823 11:39309866-39309888 CTATAAACTCTCAATAAACTAGG - Intergenic
1081171705 11:39877545-39877567 CTAAAAACTCCCAATAAGCTAGG + Intergenic
1083349153 11:62014814-62014836 CTATAGACAGAGAAGCAGCTTGG - Intergenic
1083857225 11:65399292-65399314 CTCAAAACTGAGAAGAGGCTGGG - Intronic
1083984968 11:66208059-66208081 GTATAAAATCAGCAGAAGCCTGG - Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085484667 11:76851892-76851914 TTCTAAACTCAGAAGAAACTTGG - Intergenic
1086454393 11:86947040-86947062 CTAAAAATACAGAAGTAGCTGGG + Exonic
1086912114 11:92485123-92485145 CTACAAATTAAAAAGAAGCTTGG + Intronic
1087063536 11:94006489-94006511 CTATAAACTCTCAATAAACTAGG - Intergenic
1087569473 11:99906317-99906339 CTAAAAACTCTCAATAAGCTAGG - Intronic
1087625410 11:100589957-100589979 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1087668175 11:101074286-101074308 CTAAAAACTCTCAATAAGCTAGG + Intronic
1088004304 11:104922366-104922388 CTAAAAACTCTGAATAAACTAGG - Intergenic
1088151797 11:106754537-106754559 CTAAAAACTCACAATAAACTAGG - Intronic
1089205671 11:116760507-116760529 CTATAAACGCAGAAGCTACTTGG + Intronic
1090752003 11:129754752-129754774 CTAAAAACTCTCAACAAGCTAGG + Intergenic
1090812361 11:130256707-130256729 CTAAAAACTCTGAATAAACTAGG + Intronic
1091002786 11:131924476-131924498 CTCTAAATTCAAAAGAGGCTGGG - Intronic
1092354768 12:7785471-7785493 CTATAAAAACACAAGCAGCTAGG - Intergenic
1093335688 12:17902224-17902246 CTAGAAACTCTGAATAAACTAGG - Intergenic
1093521920 12:20060981-20061003 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1093984155 12:25509850-25509872 CTAGAAACTAAGAAGATGCAAGG + Intronic
1095186962 12:39211691-39211713 CTAAAAACTCTCAAGAAACTAGG + Intergenic
1095306051 12:40640228-40640250 CTAAAAACTCTCAAGAAACTAGG - Intergenic
1095813659 12:46398154-46398176 CTAAAAACTCACAAGAAACTAGG + Intergenic
1097753229 12:63380911-63380933 CTAAAAACTCTCAAGAAACTAGG + Intergenic
1098287272 12:68920162-68920184 CTAGAAACTGAGCAGATGCTGGG + Intronic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1099185091 12:79507276-79507298 CTAAAAACTCTGAATAAACTAGG - Intergenic
1099327459 12:81237212-81237234 GTATAAACTCCCAAGAAGCTGGG - Intronic
1099542418 12:83928939-83928961 ATATAAAATAAGAAGAAACTTGG + Intergenic
1100644166 12:96511477-96511499 CTAAAAACACAAAAGTAGCTGGG - Intronic
1103205109 12:119122912-119122934 CTATAAACTGTGAAACAGCTGGG - Intronic
1105935342 13:25093608-25093630 ATATAAACTTAGAAGAATCTGGG + Intergenic
1106817218 13:33421905-33421927 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1107025620 13:35798399-35798421 CTGTAAACTCAGGAGAAGCATGG + Intronic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1108307668 13:49154699-49154721 CTAAAAACTCTGAATAAACTAGG - Intronic
1108308202 13:49159798-49159820 CTAAAAACTCTGAATAAACTAGG - Intronic
1108458661 13:50642971-50642993 CCAGAAACTAAGAAGAAGCAAGG + Intronic
1108477257 13:50833007-50833029 CTAAAAACTCTTAAGAAACTAGG + Intronic
1108545023 13:51484425-51484447 CTAAAAACTCTAAATAAGCTAGG - Intergenic
1108578158 13:51806854-51806876 TCATAAACTCATAGGAAGCTAGG + Intergenic
1109113925 13:58357036-58357058 CAATAAAGTCAAAAGAAGATAGG - Intergenic
1109465585 13:62727725-62727747 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1109683852 13:65787344-65787366 CTATAAAGTATGAATAAGCTAGG - Intergenic
1110349453 13:74490268-74490290 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1112849853 13:103692149-103692171 CTATGAGCTGAGAAGAAGTTTGG + Intergenic
1113418702 13:110152764-110152786 CTTTAAACTCTAATGAAGCTGGG - Intronic
1114253881 14:20985370-20985392 CTAAAAACAAAAAAGAAGCTGGG + Intergenic
1114360895 14:21971242-21971264 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1114888408 14:26884849-26884871 CTATAAACTCAGGAGTAGAATGG + Intergenic
1115536523 14:34378454-34378476 CTATAAACTCAGAATGGACTAGG - Intronic
1116247390 14:42433421-42433443 CTAAAAACTCTGAATAAACTAGG + Intergenic
1116552898 14:46265211-46265233 CTAAAAACTCTGAATAAACTAGG + Intergenic
1116925825 14:50635868-50635890 CTAAAAATACAGAAGTAGCTGGG - Intronic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG + Intronic
1118444843 14:65841438-65841460 CTCTTCACTCAGAAGAAGCCTGG - Intergenic
1120105721 14:80491905-80491927 ATATGAACACAGAGGAAGCTGGG - Intronic
1120444022 14:84571045-84571067 ATATAAACTCAGAATTGGCTGGG + Intergenic
1123985663 15:25643961-25643983 ATGAAATCTCAGAAGAAGCTAGG + Intergenic
1124923892 15:34052306-34052328 TTAAAAACTCTGAATAAGCTAGG + Intronic
1125453962 15:39838642-39838664 CTAAAAACTCTGAATAAACTAGG + Intronic
1126434905 15:48626613-48626635 CTATAAAGTCAGAGGAAGTTAGG + Intronic
1127364645 15:58276559-58276581 CTAAAAACACAAAAGTAGCTGGG - Intronic
1129507581 15:76095295-76095317 CTAAAAACTCTGAATAAACTAGG - Intronic
1131100448 15:89684892-89684914 TTATAATCTCAGAAGGGGCTGGG + Intronic
1131314854 15:91326344-91326366 TTAAAAACTCTGAAGAAACTAGG - Intergenic
1132082164 15:98875628-98875650 CTATAAAATCAAAACAAGCAGGG - Intronic
1132254335 15:100362275-100362297 CTAAAAACTCACAATAACCTAGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135417449 16:22279396-22279418 CAATAAACACACAAAAAGCTGGG - Intronic
1139154900 16:64429139-64429161 CTAAAAACTCAGCATAAGATAGG + Intergenic
1139155293 16:64434289-64434311 CTATAAACTCTCAATAAACTAGG + Intergenic
1140252142 16:73303643-73303665 CTATAAATTCATAGGAAGGTAGG - Intergenic
1140669038 16:77256501-77256523 CTAAAAACTCTCAATAAGCTAGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1203049702 16_KI270728v1_random:864423-864445 CTATACAACCAGAAGAATCTTGG + Intergenic
1142725015 17:1807049-1807071 CTAAAAATACAGAATAAGCTGGG - Intronic
1143746760 17:9000716-9000738 CCATAAAACCAGAAGATGCTGGG + Intergenic
1146188609 17:30745511-30745533 CTAAAAACTCAAAATTAGCTGGG - Intergenic
1146451686 17:32979561-32979583 CTCTGAACTCAGAAGGAGATCGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146494732 17:33311509-33311531 ATATATGCTCAGAAGAAACTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151634609 17:75337161-75337183 CTAGAATTTCAGAAAAAGCTTGG + Intronic
1153441615 18:5125949-5125971 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1155128215 18:22901774-22901796 CTACAAACCAAGAAGAAGCCTGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155487535 18:26362130-26362152 CTTTAGACTCAGAAAAATCTGGG + Intronic
1156208111 18:34907785-34907807 CCATAACCTGAGAAGAACCTGGG + Intergenic
1156434794 18:37115474-37115496 CTAAAAACTCTCAATAAGCTAGG + Intronic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1158310967 18:56157813-56157835 TTAAGAACTCAGAAGAAGCAGGG + Intergenic
1158385702 18:56988701-56988723 TTATAAATTCAGAAGAAGCATGG + Intronic
1158547732 18:58410313-58410335 CTGTAAACTCAGAGGAGGGTTGG - Intergenic
1158843868 18:61419849-61419871 CTATTAGCTCAGAACAAGGTAGG - Intronic
1158857723 18:61560117-61560139 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1161931810 19:7345587-7345609 CTGTAAGCTCAGAAGAAGTCAGG - Intergenic
1162522153 19:11187790-11187812 CAATAAAATCAGAAAAAGCTGGG + Intronic
1163398442 19:17077274-17077296 CTATAAACTAAACATAAGCTGGG - Intronic
1164178473 19:22798659-22798681 CTAAAAACTCAAAATAAGCCAGG + Intergenic
1165250453 19:34528958-34528980 GTAAAAACTCTTAAGAAGCTGGG + Intergenic
1165809288 19:38601108-38601130 CTAAAAATACAAAAGAAGCTAGG - Intronic
1166616384 19:44251712-44251734 CTAAAAACTCTCAATAAGCTAGG + Intronic
1167193478 19:48008838-48008860 CAAAAATCTCAGAAGAAGCTGGG + Intronic
1167199926 19:48057783-48057805 ATATAAAATAAGAAGAAGCCGGG - Intronic
1167880733 19:52455358-52455380 CTAAAAACACAAAAGTAGCTGGG - Intronic
926449576 2:12985968-12985990 CCAGATACTCAGAAGAAACTGGG - Intergenic
926503917 2:13687129-13687151 CTAAAAACACAAAATAAGCTGGG + Intergenic
926731780 2:16041109-16041131 GTAAAAACGCAGAAGAGGCTGGG + Intergenic
927396497 2:22656920-22656942 CTAAAAACACAAAAGTAGCTGGG + Intergenic
927775882 2:25902808-25902830 CTAAAAACACAGAATTAGCTGGG - Intergenic
928690831 2:33797092-33797114 CTCTTAACTCAGAAGAAGCTGGG + Intergenic
929341880 2:40829564-40829586 CTCTAAAATCAGAAGAACCTGGG + Intergenic
929495917 2:42443572-42443594 TTATGAATTCAGAAGAAGCTTGG - Exonic
929625105 2:43398615-43398637 ATAGAAACTCAGAAGAAGGATGG + Intronic
930162082 2:48168713-48168735 CTAAAAACTCAAAATTAGCTGGG + Intergenic
930586312 2:53271254-53271276 CTAAAAACTCTGAATAAACTAGG + Intergenic
930625260 2:53689935-53689957 CTAAAAACTAAGCTGAAGCTAGG + Intronic
931204306 2:60132374-60132396 CTAAAAACTCTGAATAAACTAGG - Intergenic
931558298 2:63529396-63529418 CTAAAAACTCTGAATAAACTAGG - Intronic
931558824 2:63534670-63534692 CTAAAAACTCTGAATAAACTAGG + Intronic
932088342 2:68782273-68782295 CCACAAACCCAGAAGAAGCTGGG + Exonic
932976886 2:76613448-76613470 CCAAAAACTCAAGAGAAGCTGGG - Intergenic
933412826 2:81947361-81947383 CTAAAAACTCACAATAAACTTGG - Intergenic
935934386 2:108166103-108166125 ATATAAACCAAGAAGAGGCTAGG - Intergenic
937327087 2:120996482-120996504 TTCTAAACCCAGAAGAAGCCAGG + Intergenic
938678757 2:133667034-133667056 CAAGAAACTATGAAGAAGCTAGG - Intergenic
939019594 2:136943032-136943054 CTAAAAACTCTCAATAAGCTAGG - Intronic
940409487 2:153344570-153344592 CTATAATCACAAAAAAAGCTGGG - Intergenic
940438680 2:153686822-153686844 CTAAAAACTCTCAATAAGCTAGG - Intergenic
941094180 2:161216951-161216973 CTATAAAGTAAGAAAAAGATAGG - Intronic
941559697 2:167029386-167029408 CTAAAAACTCTCAATAAGCTAGG - Intronic
941758220 2:169211730-169211752 CTACAAAATCAGAAAAATCTGGG + Intronic
941845678 2:170129882-170129904 CTAAAAACTCTGAATAAACTAGG + Intergenic
941963472 2:171276612-171276634 CAAAAAACTGAGAAGAGGCTGGG - Intergenic
942932376 2:181511014-181511036 CTAGAAAGTCAGAAGGAGCCAGG - Intronic
944164737 2:196706695-196706717 CTAAAAACTCTCAATAAGCTAGG - Intronic
944894828 2:204153177-204153199 TTATCAACTCAGAATAAACTAGG - Intergenic
945490523 2:210449312-210449334 CTAAAAACTCTGAATAAACTAGG + Intronic
945675769 2:212853837-212853859 GTATCAACAGAGAAGAAGCTGGG - Intergenic
948292937 2:236840852-236840874 CTATCAACCCAGAGCAAGCTAGG + Intergenic
1169298073 20:4417062-4417084 CTAAAAACACAAAAGTAGCTGGG + Intergenic
1170229010 20:14024567-14024589 CTAAAAACTCTCAATAAGCTAGG - Intronic
1171022327 20:21597180-21597202 AAAAAAACTCAGAAGAAGTTTGG - Intergenic
1173114463 20:40227234-40227256 CCATCAACTCAAAGGAAGCTAGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1177793714 21:25749668-25749690 CTAAAAATACAGAATAAGCTGGG + Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1184934924 22:47714188-47714210 CTATCATCTCAGCAGAGGCTGGG - Intergenic
949209026 3:1476349-1476371 ATGAAAACTCAAAAGAAGCTAGG - Intergenic
950390203 3:12690561-12690583 CTAGAAACTCGGTAGAAGCAAGG + Intergenic
951254120 3:20429301-20429323 CTAAAAACTCTCAAGAAACTAGG - Intergenic
951661446 3:25071011-25071033 CTCAAGACTCAGAAGAAGCATGG - Intergenic
951747455 3:25995307-25995329 CTAAAAACTCTCAATAAGCTAGG - Intergenic
952119741 3:30228021-30228043 CTATAAAAGCAGAAGAAAGTAGG - Intergenic
952461206 3:33528250-33528272 CTAAAAACTCTCAATAAGCTAGG + Intronic
953654901 3:44842608-44842630 CTTGAAACTTAGAAGAAACTGGG + Intronic
954507823 3:51093849-51093871 CTAAAAACTCTGAACAAACTAGG - Intronic
955642618 3:61102236-61102258 CTAAAAACTCTGAATAAACTAGG - Intronic
955794758 3:62623978-62624000 CTATAAACTGAGTAGATGCCAGG - Intronic
956148861 3:66220719-66220741 CTGTAAACCCAGAAGAGGCGTGG - Intronic
956269781 3:67439197-67439219 CTAAAAACTCTGAATAAACTTGG + Intronic
956429011 3:69165747-69165769 CTGTAAAGCCAGGAGAAGCTTGG - Intergenic
957798164 3:85039160-85039182 CTAAAAACACAAAATAAGCTGGG - Intronic
958422630 3:93945619-93945641 CTAAAAACTCTCAATAAGCTAGG + Intronic
958694209 3:97507345-97507367 CTAAAAACTCTGAATAAACTAGG - Intronic
959121739 3:102241108-102241130 CAATGACCTCAGAAGGAGCTGGG + Intronic
959953053 3:112202915-112202937 CAATGAACTCTGCAGAAGCTAGG - Intronic
960904278 3:122583958-122583980 AAAGAAACTCAGAAGAAGCCTGG - Intronic
961992715 3:131209146-131209168 CTAAAAACTCTCAATAAGCTAGG - Intronic
962264810 3:133937316-133937338 TTATAAACACAGAGGAAGCAGGG - Intronic
962789062 3:138794256-138794278 TTAAAAACTCACAAGATGCTGGG - Intronic
962913746 3:139879612-139879634 CTAAAAACTCTCAAGAAACTAGG - Intergenic
963823563 3:149926503-149926525 CTAAAAACACAGAAGAGGCTGGG - Intronic
964049058 3:152369191-152369213 CTAAAATCTCTCAAGAAGCTAGG - Intronic
964265892 3:154894932-154894954 CTAAAAACTCACAATAAACTAGG + Intergenic
965393389 3:168132250-168132272 CTAAAAACTCTGAATAAACTAGG + Intergenic
965636243 3:170784174-170784196 CTATTATCTCAGAAGGAACTTGG + Intronic
965681570 3:171257174-171257196 CTAGAGACTTAGAAGAAGCAAGG + Intronic
966088397 3:176099902-176099924 CTATAAAATTAGAAGATGCTTGG + Intergenic
966150736 3:176865224-176865246 CTAAAAACTCTGAATAAACTAGG + Intergenic
966255493 3:177912418-177912440 CTAAAAACTCTGAATAAACTCGG + Intergenic
966477905 3:180371320-180371342 CTAAAAACTCTCAATAAGCTAGG + Intergenic
968560851 4:1280988-1281010 CTATAAACACAAAAGAAACAGGG + Intergenic
970634671 4:17994841-17994863 CTATAAGCTCCAAAGAAGCAAGG + Intronic
970685603 4:18563361-18563383 CTACAAACTCTCAATAAGCTAGG + Intergenic
971098977 4:23441245-23441267 GTATGAACTAAGGAGAAGCTGGG - Intergenic
971648047 4:29233599-29233621 CTAAAAACTCTCAATAAGCTAGG + Intergenic
971660796 4:29412960-29412982 TTATAAACTTAGGAGAAGGTTGG + Intergenic
971832048 4:31707069-31707091 CTATAAACTGACCTGAAGCTGGG - Intergenic
971893927 4:32564802-32564824 CCAGAAACTCAGAAGAAGCATGG - Intergenic
972025212 4:34367272-34367294 CTACCAACTGAGAAGCAGCTAGG - Intergenic
972107450 4:35507711-35507733 CAATTTACTAAGAAGAAGCTGGG + Intergenic
972307032 4:37840682-37840704 CTCTAAAATCAGATGCAGCTGGG - Intronic
972890826 4:43554111-43554133 CTATAAACTCAAAAGCAAGTTGG - Intergenic
973938410 4:55876523-55876545 CTGAAAACTCAGACTAAGCTTGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974272538 4:59669695-59669717 CTTTGAACTCTGAAGTAGCTTGG + Intergenic
974644265 4:64671906-64671928 CTACAATCTCAGAACAAGATTGG - Intergenic
974990201 4:69077960-69077982 CTAAAAACTCTCAATAAGCTAGG - Intronic
975289009 4:72655098-72655120 CTAAAAACTCTCAAGAAACTAGG + Intergenic
975306128 4:72850728-72850750 CTAAAAACTCACAATAAACTAGG + Intergenic
975581712 4:75912611-75912633 CTAAAAATACAGAATAAGCTGGG + Intergenic
975761664 4:77626038-77626060 AAATAAAATCAAAAGAAGCTTGG - Intergenic
978426272 4:108585938-108585960 TTATAGTCTCAGAAGTAGCTTGG + Intergenic
980151299 4:129051907-129051929 CTAAAAACTCTCAATAAGCTAGG - Intronic
980414380 4:132465947-132465969 CTAAAAACTCACAATAATCTAGG - Intergenic
981501955 4:145461444-145461466 CTAAAAACTCTGAATAAACTAGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982725204 4:158899024-158899046 CTATAAACTCTCAATAAACTAGG - Intronic
982734243 4:158988698-158988720 CTATAAACTCTCAATAAACTAGG + Intronic
983212315 4:164971428-164971450 CTAAAAACACAGAATTAGCTGGG + Intronic
983726515 4:170935250-170935272 CTATACACTCATGAGAAGATGGG - Intergenic
984903492 4:184605772-184605794 CTAAAAACTCCGAATAAACTAGG + Intergenic
984960668 4:185094426-185094448 TTATAAACTTAGAAAAGGCTGGG + Intergenic
986675551 5:10181584-10181606 CTAAAAACTCTCAATAAGCTAGG + Intergenic
988012856 5:25512815-25512837 CTAAAAACTCACAATAAGCTAGG - Intergenic
989083709 5:37653121-37653143 CTAAAAACTCTCAAGAAACTAGG - Intronic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
990239934 5:53806732-53806754 CTAAAAACTCTCAATAAGCTAGG + Intergenic
990984456 5:61628192-61628214 CTAAAAACTCTGAATAAACTAGG + Intergenic
991044566 5:62209555-62209577 CTATGTACTCAGAAGAGTCTGGG - Intergenic
991137233 5:63196198-63196220 ATAAAAACTCTGAAAAAGCTAGG + Intergenic
991281203 5:64916329-64916351 CTTTAAAGTCAGAAAAACCTAGG + Intronic
992963090 5:81974774-81974796 CTTAAAACTCAAAGGAAGCTTGG - Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995211251 5:109541954-109541976 CTAAAAACTCTCAATAAGCTAGG + Intergenic
995353186 5:111205830-111205852 CCAAAAACTCAGAAGAGGATTGG - Intergenic
995471572 5:112507487-112507509 CTAAAAACTCTCAATAAGCTAGG + Intergenic
995563879 5:113412952-113412974 CTAAAAACTCTCAATAAGCTAGG - Intronic
995642620 5:114275015-114275037 CTAAAAACTCACAATAAACTAGG - Intergenic
995750204 5:115446009-115446031 CTAAAAACTCTCAATAAGCTAGG + Intergenic
996276964 5:121678674-121678696 CTAAAAACTCTGAATAAACTAGG - Intergenic
996406502 5:123110725-123110747 CTAAAAATACAGAATAAGCTGGG - Intronic
997404005 5:133629153-133629175 CTAAAAACTCTCAATAAGCTGGG - Intergenic
997404076 5:133629956-133629978 CTAAAAACTCTCAATAAGCTAGG + Intergenic
997496677 5:134333494-134333516 CTAAAAACTCTGAATAAACTAGG - Intronic
997605678 5:135174243-135174265 CTCTTAACACAGAAGAGGCTGGG - Intronic
999964089 5:156789425-156789447 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1001261171 5:170230539-170230561 TTAAAAACTCAGAAAAAGATAGG - Intergenic
1001383619 5:171319927-171319949 CTATAAACTCAGGCGTAACTAGG - Intergenic
1002197004 5:177506848-177506870 CTAAAAATACAGAAGTAGCTGGG - Intronic
1004224233 6:13771602-13771624 TTTTTAACTCAGAAGAAGTTGGG + Intergenic
1004290254 6:14360511-14360533 CTATAAACTCAGAAATAAATGGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005590649 6:27322521-27322543 CTATAAAATAAGGAGCAGCTGGG - Intergenic
1005965262 6:30722148-30722170 CTTAAAAATTAGAAGAAGCTGGG + Intronic
1008045420 6:46847210-46847232 TTATAAAGTGAGATGAAGCTGGG + Intergenic
1008167395 6:48155274-48155296 CTATAAACTCTCAACAAACTAGG + Intergenic
1008225377 6:48908147-48908169 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1008231489 6:48989660-48989682 CTACCAACTCAGAAGGAGGTGGG - Intergenic
1008474353 6:51920308-51920330 CTAAAAACTCTGAATAAACTAGG - Intronic
1008785466 6:55162297-55162319 CTAAAAACTCTCAATAAGCTAGG + Intronic
1009652425 6:66492986-66493008 CTATAAACTCTCAATAAGCTAGG + Intergenic
1009668106 6:66708854-66708876 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1009983622 6:70756560-70756582 CTTTTAGGTCAGAAGAAGCTTGG + Intronic
1010540280 6:77084656-77084678 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1011318352 6:86061972-86061994 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1011884968 6:92082248-92082270 CTAAAAACTCTGAATAAACTAGG + Intergenic
1013025403 6:106266811-106266833 CTAAAAACTCTCAATAAGCTAGG + Intronic
1013182951 6:107733319-107733341 TTATTAACTCAGCAGTAGCTAGG + Intronic
1013302268 6:108815268-108815290 CTAAAAACTCACAATAAACTAGG - Intergenic
1013901536 6:115162821-115162843 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1013904496 6:115199009-115199031 CTATACGCTCAGAAAAAGCCAGG + Intergenic
1013932351 6:115548975-115548997 TTAAAAACTCTGAAGAAACTAGG + Intergenic
1014223175 6:118819301-118819323 CTAAAAACTCTCAATAAGCTAGG - Intronic
1016523537 6:144973883-144973905 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1016638292 6:146320146-146320168 CTAAAAAATCACAATAAGCTAGG - Intronic
1017372646 6:153731495-153731517 CTAAAAACTCTGAATAAACTAGG + Intergenic
1019536628 7:1532794-1532816 CTTTAGACTCAGAAACAGCTGGG - Intronic
1021884028 7:25120961-25120983 CTAAAAACACAAAATAAGCTGGG + Exonic
1022919863 7:35002347-35002369 ATAAAAACTCAGTAGAAGGTTGG + Intronic
1023064333 7:36361593-36361615 CTAAAAACTCAAAAGAAGCTAGG + Intronic
1023697337 7:42861293-42861315 CTAAAAACACACAAGAAACTAGG - Intergenic
1024441260 7:49420945-49420967 ATATAAAATCAAAAGAAGATTGG - Intergenic
1024842741 7:53605274-53605296 CTAACAACTCGGAAGAAACTGGG + Intergenic
1027739075 7:81977232-81977254 CTAAAAACTCATAATAAACTAGG - Intronic
1027878631 7:83803015-83803037 CTATAAATTCAGATAAAGTTTGG + Intergenic
1028080650 7:86571139-86571161 CTAAAAACTCTGAATAAACTAGG + Intergenic
1028429571 7:90732021-90732043 CTAAAAACTCTCAAGAAACTAGG - Intronic
1028648607 7:93125287-93125309 CTAAAAACTCCCAATAAGCTAGG + Intergenic
1029311257 7:99667225-99667247 ACATACACTCAGAAGAGGCTAGG - Intronic
1029322291 7:99774651-99774673 CTAAAAACTCTGAATAAACTAGG + Intronic
1030218551 7:107073409-107073431 CTATAAACTCTTAAGATGCTAGG - Intronic
1030520925 7:110596949-110596971 GGATAGACTCGGAAGAAGCTGGG - Intergenic
1030925414 7:115447529-115447551 TTATAAACCCAAAGGAAGCTAGG - Intergenic
1031391719 7:121223137-121223159 CTAAAAACTCAAAATAAACTAGG - Intronic
1034039767 7:147865108-147865130 CTAAAAACTCCCAATAAGCTAGG - Intronic
1035150464 7:156866895-156866917 CTAAAAACTCATAAGAGGCTGGG - Intronic
1035235632 7:157496108-157496130 CTAAAAACACAGAATCAGCTGGG - Intergenic
1037087382 8:14869398-14869420 CTAAAAACTCACAATAAACTAGG + Intronic
1038256904 8:25958633-25958655 TTAAAAAATTAGAAGAAGCTGGG - Intronic
1040563710 8:48547167-48547189 CAGAAAACTCAGAAGTAGCTAGG + Intergenic
1042887919 8:73572707-73572729 CTAAAAACTCTGAAAAAACTAGG + Intronic
1042965095 8:74342639-74342661 CTATGAACTCAAAACAATCTTGG + Intronic
1043082684 8:75785180-75785202 CTATAAACTCAGAAAGGGGTGGG + Intergenic
1043589417 8:81810698-81810720 TTTTAAACTCAGAAGACACTTGG + Intronic
1043987625 8:86712839-86712861 CTACAAACTCCCAAGTAGCTAGG + Intronic
1044048098 8:87463267-87463289 CTAAAAACTCTGAATAAACTAGG - Intronic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044468398 8:92535390-92535412 CTAGAAGCTCAACAGAAGCTGGG + Intergenic
1044470281 8:92559011-92559033 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1045747089 8:105435699-105435721 ATTTAAACTAGGAAGAAGCTTGG + Intronic
1045849589 8:106677505-106677527 GTAAAAACTCAAAAGAAGTTTGG - Intronic
1046073904 8:109293767-109293789 CTAGAAACTGAGAGGAAGCAAGG - Intronic
1046214369 8:111124302-111124324 TTACAAACTCACAAGAAGCCTGG - Intergenic
1046544869 8:115637192-115637214 CAAGAAACAGAGAAGAAGCTAGG + Intronic
1049954068 9:675362-675384 CCATGAAATCAGAAGAAGTTGGG - Intronic
1050300120 9:4249800-4249822 CTAAAAACTCTCAATAAGCTAGG - Intronic
1050352577 9:4754396-4754418 CTAAAAACACAAAAGTAGCTGGG + Intergenic
1051577768 9:18636747-18636769 CTATAAACAAAGAAGAGGATGGG + Intronic
1051843322 9:21423327-21423349 CTAAAAACTCTCAAGAAACTAGG - Intronic
1052630849 9:31036602-31036624 CCATAGCCTCAGAAGTAGCTGGG - Intergenic
1052727448 9:32246078-32246100 ATATAAAATCAAGAGAAGCTTGG - Intergenic
1053525883 9:38830122-38830144 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1053652146 9:40179523-40179545 TTATAAAGTGAGATGAAGCTTGG - Intergenic
1053902539 9:42808837-42808859 TTATAAAGTGAGATGAAGCTTGG - Intergenic
1054198114 9:62054547-62054569 CTTTAAAAACAGAAGAATCTGGG + Intergenic
1054532438 9:66196683-66196705 TTATAAAGTGAGATGAAGCTTGG + Intergenic
1054640240 9:67533816-67533838 CTTTAAAAACAGAAGAATCTGGG - Intergenic
1055123755 9:72694466-72694488 TTAAAAACTAAGAATAAGCTTGG + Intronic
1056001318 9:82219888-82219910 CTAAAAACTCTCAAGAAACTAGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187635243 X:21220798-21220820 CTAAAAACTCTGAATAAACTAGG - Intergenic
1187769614 X:22680771-22680793 CTAAAAACTCTCAAGAAACTAGG + Intergenic
1188892912 X:35632581-35632603 CTATAAACTCTTAATAAACTAGG - Intergenic
1188969216 X:36592760-36592782 CTAAAAACTCTTAATAAGCTAGG + Intergenic
1189039398 X:37526639-37526661 CTAAAAACTCTCAATAAGCTAGG - Intronic
1189501627 X:41566044-41566066 CTAAAAACTCAGAATAAGCTAGG + Intronic
1190081928 X:47363417-47363439 TTAGAAACACAAAAGAAGCTGGG + Intergenic
1190459125 X:50653745-50653767 CTAAAAACTCTCAATAAGCTAGG - Intronic
1190840992 X:54144123-54144145 CTAAAAACTCTCAATAAGCTAGG + Intronic
1190914869 X:54803885-54803907 CCATAAACTCTGAAGAACCTAGG - Intergenic
1191088368 X:56593897-56593919 CTAGAAACTCTGAATAAACTAGG - Intergenic
1191115743 X:56850787-56850809 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1191139264 X:57098572-57098594 CTAAAAACTCTGAATAAACTAGG + Intergenic
1191207072 X:57846042-57846064 CTATAAACTCTCAATAAACTAGG + Intergenic
1191606508 X:63068300-63068322 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1192982514 X:76361229-76361251 GTAAAAACTCTGAATAAGCTAGG - Intergenic
1193222977 X:78948620-78948642 CTAGAGACTCAGAAGAGGGTGGG - Intronic
1193281163 X:79652578-79652600 CTAAAAACTCTGAATAAACTAGG - Intergenic
1193303846 X:79925949-79925971 CTAAAAACTCTGAATAAACTAGG + Intergenic
1193907120 X:87257546-87257568 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1194230911 X:91322529-91322551 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1194362918 X:92976743-92976765 CTATAAACTCATAAAAATATGGG - Intergenic
1194934100 X:99926789-99926811 CTACAAACTCTGAATAAACTAGG + Intergenic
1195149538 X:102052066-102052088 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1196045668 X:111253915-111253937 GTATAAAGTCAGTAGAAGCCAGG - Intronic
1196487611 X:116231884-116231906 CTATAAACTCCGAAAAATATTGG - Intergenic
1197490098 X:127105850-127105872 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1197991658 X:132325309-132325331 CTAAAAACTCACAATAAACTAGG + Intergenic
1198503984 X:137282609-137282631 CTTTAAACTCTGAAAAAGCAAGG + Intergenic
1198519368 X:137437240-137437262 CTAAAAACTCCCAATAAGCTAGG + Intergenic
1198678186 X:139153253-139153275 CTATAAAACCAGAAATAGCTGGG - Intronic
1200671161 Y:6092972-6092994 CTATAAACTCATAAAAATATGGG - Intergenic