ID: 1108072701

View in Genome Browser
Species Human (GRCh38)
Location 13:46644741-46644763
Sequence CCCCAGTGTAGGCCTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108072701 Original CRISPR CCCCAGTGTAGGCCTGGGCA TGG Intronic
900469323 1:2845303-2845325 CCCCAGTCAAGGTATGGGCAGGG + Intergenic
900536194 1:3178965-3178987 CCCAAGGGAAGGGCTGGGCAAGG - Intronic
900576546 1:3385404-3385426 CCCCACTGCAGGCCAGGGCTTGG - Intronic
900618833 1:3577776-3577798 CCGCAGTGCTGGCCTGGGCCTGG + Intronic
901468893 1:9441774-9441796 CCCCACTGTATCTCTGGGCAGGG - Intergenic
901940322 1:12656848-12656870 ACTCAGTGTAAGGCTGGGCATGG + Intronic
902264956 1:15256706-15256728 CCTCGGTGTAGGGCAGGGCAGGG - Intronic
903166116 1:21521612-21521634 CACCAGTGAAGGTCTGGGGAGGG - Intronic
903662174 1:24984880-24984902 TGCAAGTGTGGGCCTGGGCAGGG - Intergenic
904498374 1:30900501-30900523 CCCAACTGTGGGCCTGGACAGGG + Intronic
904614645 1:31743229-31743251 CCCCTGTGGACGCCTGGACAAGG + Intronic
905403453 1:37718589-37718611 CCCCAGTATAGGCAGGGGCAGGG + Intronic
905416137 1:37805741-37805763 CCCCACTCTAGGTCTGGGAATGG + Intronic
907426817 1:54384998-54385020 CTCCAGAGTAGGCCTGGGCAGGG + Intronic
907529250 1:55076932-55076954 CTCCACTGTAGGCCCTGGCAGGG + Intronic
908124676 1:61018490-61018512 GCACAGTGTTGGGCTGGGCACGG - Intronic
908959444 1:69677873-69677895 CCACAGTGAAGGCCTGCACAAGG - Intronic
911172244 1:94782276-94782298 CTACAGTGTAGGGCTTGGCAGGG - Intergenic
911524888 1:98972801-98972823 GGCTAGTGTAGGCCTGGGCATGG + Intronic
914847575 1:151291476-151291498 CCCCAGTGTGGGCCTGGGGGTGG + Exonic
915835219 1:159171276-159171298 AGCCACTGCAGGCCTGGGCAAGG - Intergenic
916950223 1:169772546-169772568 CCCCAGTAGTTGCCTGGGCAAGG - Intronic
917794315 1:178521764-178521786 CTCCAGTGGAGGCCTGGGGTTGG - Intronic
918181396 1:182088118-182088140 CCCCAGTTTTGCCCTGGGCTGGG - Intergenic
919753615 1:201053363-201053385 CCCCAGGGGAGCCCTGGGCAAGG - Intronic
919895438 1:202007081-202007103 GCCCAGTGAAGCCTTGGGCATGG - Intergenic
920683463 1:208090853-208090875 CACCATGGGAGGCCTGGGCAGGG - Intronic
921221434 1:212976789-212976811 CACCAGAGTGGGCCTGGGAATGG + Intronic
922227526 1:223658510-223658532 CCCCAGCTTTGGGCTGGGCATGG + Intronic
922722374 1:227905544-227905566 CCACAGCGAGGGCCTGGGCAGGG - Intergenic
922798991 1:228355569-228355591 CCCCAGGGGATGCCTGGGCAGGG - Intronic
1062910625 10:1209473-1209495 CGACAGTGTAGGCATGGGCATGG - Intronic
1063101267 10:2951965-2951987 CCCCAGTGTGGGCAGGAGCAGGG - Intergenic
1064272461 10:13877892-13877914 TCCCCATGTAAGCCTGGGCATGG + Intronic
1066996643 10:42570359-42570381 GGACAGTGTAGGCCTGGGCCTGG - Intergenic
1067569391 10:47360428-47360450 CTCCTGTGTAGGCCTGTGCGGGG - Intergenic
1067804311 10:49382551-49382573 GCCCAATCTAGGCCTGGGCAAGG - Intronic
1069809825 10:71150074-71150096 TCCTAGTGTAGGCCTAGGTATGG + Intergenic
1069826533 10:71258256-71258278 CCTCAGTCTGGGCCAGGGCAGGG + Intronic
1069867258 10:71511532-71511554 TCCAAATGTGGGCCTGGGCAGGG + Intronic
1070283553 10:75067600-75067622 CCCCTGTGTAGGGTTGGGCTGGG + Intergenic
1070811283 10:79299260-79299282 CCCGAGTGGGGCCCTGGGCAGGG + Intronic
1070995656 10:80778031-80778053 CATCAGTGTAGGCCTGGCCCAGG + Intergenic
1071525396 10:86355298-86355320 CTCCAGTGGAGGCATGGGGAAGG + Intronic
1072615777 10:97048162-97048184 CCCCAGTGTCAGCCTGGGCAAGG - Intronic
1073538654 10:104300375-104300397 CCCCAGTGTGCCCCTGGGCTTGG - Intronic
1075004192 10:118818716-118818738 CTCCCGGGAAGGCCTGGGCACGG - Intergenic
1076658191 10:132037860-132037882 CCCCAGAGCAGCCCTGGGCCAGG - Intergenic
1076872110 10:133199287-133199309 CCCCAGAGGAGGCCCGGGCCAGG + Intronic
1077107487 11:848408-848430 CCCCAGCGAGGACCTGGGCATGG + Intronic
1077187988 11:1243960-1243982 CACCAGGCTGGGCCTGGGCACGG - Exonic
1077188414 11:1245631-1245653 CACCAGGCTGGGCCTGGGCACGG - Exonic
1077188944 11:1247731-1247753 CACCAGGCTGGGCCTGGGCACGG - Exonic
1077189370 11:1249402-1249424 CACCAGGCTGGGCCTGGGCACGG - Exonic
1077371872 11:2186111-2186133 CCCCACTGTCCGCCTGGGCAGGG + Intergenic
1077407305 11:2388439-2388461 CCCCAGGGTGGGGTTGGGCAGGG - Intronic
1078068638 11:8094231-8094253 CTCCACTGTAGGGCTGGGGAAGG + Intronic
1078855808 11:15205874-15205896 TCTCTGTGTTGGCCTGGGCAAGG + Intronic
1079088603 11:17464917-17464939 TCCCTATGTGGGCCTGGGCATGG + Intronic
1079312513 11:19379030-19379052 CCCCAGTGTGTGCAGGGGCAGGG + Intronic
1080271193 11:30452364-30452386 CCACAGGATGGGCCTGGGCAGGG - Intronic
1080706575 11:34701251-34701273 CAGCAGAGGAGGCCTGGGCAGGG + Intergenic
1081436795 11:43035542-43035564 CCCCAGCAGAGGCCTAGGCATGG - Intergenic
1081906654 11:46674574-46674596 CCCCAGTGCAGGTCTGGGAAAGG + Intronic
1083609664 11:63998902-63998924 CCCCAGGGTGGACCGGGGCAGGG + Intronic
1083928352 11:65823292-65823314 CATCAGTGGAGGCCTGGGCTTGG + Intronic
1084547319 11:69820903-69820925 GCCCTGTGCAGGCCTGGGCTGGG + Intergenic
1084858342 11:72002958-72002980 CCCCAGTGCAAGTCTGGGGAAGG + Exonic
1086090852 11:83003357-83003379 CCCCAGAGAAGGTCTGGGTAGGG - Intronic
1089318397 11:117607612-117607634 CCCCAGTGAAGGCTGAGGCAGGG + Intronic
1096104324 12:48987569-48987591 CCCCAGAGTAGGCCTGGTACAGG - Intergenic
1096186687 12:49586228-49586250 TCCCAGTGGAGGCCTGGGTGTGG + Intronic
1096310389 12:50515516-50515538 CCACAGTGTAGGGCTGGGCATGG - Intronic
1098848249 12:75564437-75564459 CAGCAGAGTGGGCCTGGGCACGG - Intergenic
1099768379 12:87020596-87020618 CCCCATTGCAGGCCTGGGGCAGG + Intergenic
1102412662 12:112733597-112733619 CCCCAGTCAATGACTGGGCATGG - Intronic
1103932691 12:124458914-124458936 GCCCAGTGAAGGACTGGGTATGG + Intronic
1104842988 12:131833520-131833542 CCCCAGAGGAGGCCGGTGCAGGG + Intronic
1104879738 12:132062276-132062298 CCCCAGTGCAGACCCCGGCACGG + Exonic
1104981947 12:132577159-132577181 CCCCAGGGTGGACCTGGGCCTGG + Intronic
1106122501 13:26872375-26872397 CTCCAGTGTAGTTTTGGGCAAGG + Intergenic
1106820057 13:33454940-33454962 CCAGAGTGTAGGCCAGGGCCTGG - Intergenic
1107058111 13:36128602-36128624 CCCCACTGAAGGTCTGGGGAGGG + Intronic
1107784825 13:43944411-43944433 CCCTAGGTTAGGCCTGAGCAAGG + Intergenic
1108072701 13:46644741-46644763 CCCCAGTGTAGGCCTGGGCATGG + Intronic
1108530753 13:51325045-51325067 CCCCTCTGCAGGCCTGGGCAGGG - Intergenic
1110549481 13:76796201-76796223 GCACATTGTAGGCCTGGGAATGG - Intergenic
1113328803 13:109309442-109309464 CCTCAGTGAGGGCCTGGTCATGG - Intergenic
1114484661 14:23055644-23055666 CCCCAGCCCGGGCCTGGGCAGGG - Exonic
1115963677 14:38863623-38863645 CCCCATTGTAAGCCTGGGGCGGG - Intergenic
1116654247 14:47631314-47631336 CTCCAGTGTAGGCCAGAGGAAGG - Intronic
1117549303 14:56817702-56817724 CCCCAGTGTGAGCCAGGGCGCGG + Intergenic
1119268095 14:73276994-73277016 CCACAGGATAGGACTGGGCAGGG + Exonic
1119740262 14:77009458-77009480 CCCCTCTGGAGGCCTGAGCAGGG - Intergenic
1121250113 14:92493142-92493164 CTCTAGAGAAGGCCTGGGCAAGG + Intronic
1122234239 14:100323047-100323069 ACACAGTGAAGGCCTGGGCTTGG + Intergenic
1122640425 14:103156185-103156207 ACCCCATGCAGGCCTGGGCAGGG + Intergenic
1122925611 14:104898102-104898124 CCCTAGGGTAGGGCTGGGCCTGG + Intergenic
1123110840 14:105866259-105866281 AGCCAGTGCAGGCCTGGGGAGGG - Intergenic
1124037544 15:26069695-26069717 CCCCAGAAGAAGCCTGGGCAGGG + Intergenic
1127763831 15:62165506-62165528 CCCCAGGCAAGGCCTGGGAAAGG + Intergenic
1127812913 15:62580063-62580085 CCCCACTGCAGGCCAGGGCCTGG - Intronic
1128498021 15:68209328-68209350 CCCCAGTGTTGCCCTGGGGCCGG - Intronic
1128643852 15:69360539-69360561 CCCCAGTGAAGGCCTGGCCTGGG - Intronic
1128780254 15:70354442-70354464 CCCCGCTGTGGGCCTGGGCCCGG + Intergenic
1129305029 15:74653960-74653982 CTGCAGTGTAGGGCTGGGCGCGG + Intronic
1129760065 15:78124153-78124175 CCTCACTGTAGCCCTGAGCATGG + Intronic
1130726587 15:86445402-86445424 CCTCAGTGAAGGCTTGGTCAGGG + Intronic
1131121033 15:89823525-89823547 CCCCAGGGCAGGGCAGGGCAGGG + Intergenic
1132469809 16:96079-96101 CCCCAGTCAAGGCCACGGCAGGG + Intronic
1132779608 16:1615085-1615107 CCTCAGTGTAGGCCGCGGGATGG - Intronic
1132866272 16:2094124-2094146 TCCCAGTTCAGGCCTGGGCTGGG + Exonic
1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG + Intronic
1134007592 16:10828480-10828502 CCCTAGTGGAGGCATGGGGAGGG - Intergenic
1135066165 16:19311992-19312014 CTCCAGTGTAGTACTGGGGAGGG - Intronic
1135599399 16:23769190-23769212 CCCCAGCGAAGGACTGAGCAAGG + Intergenic
1136455150 16:30376135-30376157 TCACAGTGAAGGCCTGGGGAGGG - Exonic
1136927472 16:34388476-34388498 CCCCAGTGTGGGACCGGGCGCGG + Intergenic
1136977102 16:35023330-35023352 CCCCAGTGTGGGACCGGGCGCGG - Exonic
1137272554 16:46911767-46911789 CCCAAGTGTGGTCCTGGGCCCGG - Intronic
1138227607 16:55310869-55310891 AACTAGTGTATGCCTGGGCAAGG + Intergenic
1138787611 16:59865627-59865649 CCACACTATAGGCCTGGGCCCGG + Intergenic
1141904519 16:87015316-87015338 CTCCAGCGTAGGATTGGGCAGGG + Intergenic
1142483154 17:230715-230737 CCCCAGTGAAGTCGTGGGCAGGG - Intronic
1144454746 17:15409396-15409418 CCCCTGCGTAGGGCAGGGCAGGG + Intergenic
1144943761 17:18959433-18959455 CCCCTCTCTAGGTCTGGGCAAGG - Intronic
1146138508 17:30344337-30344359 CCCTGGTGTAAGCCTGGGTATGG + Intergenic
1148201046 17:45750247-45750269 CCCCACTGTAGGGTGGGGCAGGG - Intergenic
1148674094 17:49435036-49435058 CCCCAGTTGTGGCCTGGGAAGGG + Intronic
1150132374 17:62676086-62676108 CCCCAGTGTAGGGCAGGGCCCGG + Intronic
1150231424 17:63553911-63553933 CCCCATTATAGGGCTGGGCGTGG + Intronic
1151554333 17:74839026-74839048 CCCCGGTGCAGGCCAGGTCAAGG + Exonic
1151745892 17:76011638-76011660 CCTCAGTATAGGCCTTTGCAAGG + Exonic
1151872866 17:76848444-76848466 CCCCAGTGTGCGCTTGGCCAGGG - Intergenic
1152070789 17:78132684-78132706 ACCCTGGGGAGGCCTGGGCAGGG - Intronic
1153030685 18:710620-710642 CCTAAGTGGAGGCCTAGGCAGGG - Intronic
1157113159 18:44840049-44840071 CCCCAGAAGAGGCCTGTGCATGG + Intronic
1158877552 18:61747859-61747881 CCCCAGTGTATGCTTGGGTGGGG - Intergenic
1159463707 18:68752394-68752416 ACCCAGTGAAGGCCAGGGAAAGG + Intronic
1160700555 19:504904-504926 CCCAGGTGTCGGCCTGGGCTGGG + Exonic
1160852556 19:1199888-1199910 CTGGAGTGTAGACCTGGGCAGGG + Intronic
1161073446 19:2273709-2273731 CCCCAGCCTGGGCCTGCGCATGG + Intronic
1161405288 19:4088123-4088145 CCACTGTGGAGGCCTGGGAAGGG - Intergenic
1161707556 19:5829243-5829265 CCCCCGTGGAGGCCCGGCCAGGG - Intergenic
1161766932 19:6213396-6213418 CATCCGTGTAGGCCTGGGGAGGG + Exonic
1162315407 19:9935872-9935894 CCCCAGTGTGGGGCAGGGGACGG - Intronic
1162460489 19:10811414-10811436 CCCCAGTGCAGGGCATGGCAGGG - Intronic
1162479692 19:10921162-10921184 CCCCTGGGCAGTCCTGGGCATGG - Intronic
1162772457 19:12957275-12957297 GCCCGGTGTGGGCCAGGGCAGGG + Intergenic
1164060409 19:21667983-21668005 CCTCAGTGTCAGCCTGGACATGG + Intergenic
1164716503 19:30394480-30394502 CCCAGGTGTAGGACTGGGCCAGG + Intronic
1166303061 19:41922894-41922916 CTCCAGCCCAGGCCTGGGCATGG - Intronic
1166865668 19:45835287-45835309 CCCCAGTATTGGCATGGGCATGG - Intronic
1166990631 19:46690525-46690547 ACCCAGTGTAGGGGTGGTCAGGG - Intronic
1168080685 19:54008066-54008088 CCACAGTGAATGGCTGGGCACGG + Intronic
1168713287 19:58513668-58513690 CCCCAGGGTCAGGCTGGGCAAGG - Exonic
925653930 2:6124460-6124482 CTCCAGTGTAAGCCTGGGCCTGG + Intergenic
928679096 2:33680744-33680766 CTGCAGTGGAGGCCTGGGTATGG - Intergenic
929963053 2:46510992-46511014 CACCACTGTGGGCCTGGGCCAGG + Intronic
931431051 2:62209301-62209323 CCCCAGGGCAGCCTTGGGCAAGG + Intronic
932095041 2:68839761-68839783 CCCAGGTGTTGGACTGGGCATGG + Intergenic
935573574 2:104687304-104687326 CCCCAGTGGGGACCTGGGCCAGG + Intergenic
936091791 2:109506317-109506339 TCCCAGCATAGGCCTGGCCATGG - Intergenic
936146902 2:109986478-109986500 CTCCAGTGTCGGGCTGGGCAAGG - Intergenic
936151484 2:110024439-110024461 CCCCAGGTGAGGCCTGGGCAGGG + Intergenic
936193190 2:110346930-110346952 CCCCAGGTGAGGCCTGGGCAGGG - Intergenic
936197790 2:110385005-110385027 CTCCAGTGTCGGGCTGGGCAAGG + Intergenic
936407552 2:112220529-112220551 CCCCTTTGTAGGGCTGGGCGCGG + Intronic
937230822 2:120397163-120397185 CCCCAGGGCAGGGCAGGGCAGGG - Intergenic
937316286 2:120933872-120933894 CCCCAGGGCAGGGCAGGGCAGGG - Intronic
937342235 2:121098677-121098699 CCCTAGTGCACCCCTGGGCAAGG - Intergenic
939939567 2:148333549-148333571 CCCCAGTTCAAGGCTGGGCACGG + Intronic
940974391 2:159926999-159927021 GCCCAGTGTGGGGCTGGGAAAGG - Intergenic
945140869 2:206685077-206685099 CTTCTGTGCAGGCCTGGGCAAGG - Intronic
945280587 2:208031845-208031867 CCCCAGAGGAGGCCTGTGGAGGG - Intergenic
945892381 2:215443338-215443360 CCCCAGTGTGGGCATGACCAAGG - Intergenic
947584012 2:231340912-231340934 AACAAGTGTAGGGCTGGGCATGG + Intronic
948691619 2:239707758-239707780 CCCCAGGGCAGGGCAGGGCAAGG - Intergenic
948747297 2:240106009-240106031 CTTCAGTGCAGGCCAGGGCACGG + Intergenic
1170645413 20:18193004-18193026 CCACAGTGTGAGCCTGGGCAAGG + Intergenic
1172122635 20:32607874-32607896 CCCTATTCTAGGCCCGGGCAAGG - Intronic
1172395869 20:34604672-34604694 CCCCAGAGAAGGCTTGGGGAAGG + Intronic
1172729122 20:37070773-37070795 ACCCAGAATTGGCCTGGGCACGG - Intronic
1173648972 20:44651268-44651290 GCGCTGTGTGGGCCTGGGCAGGG - Intronic
1174176963 20:48651357-48651379 CCCCAGGGTAGGGCAGGGCCAGG + Intronic
1174303520 20:49599461-49599483 CCTCAGTGTGGGCCTAGACAAGG - Intergenic
1174339434 20:49886742-49886764 CCACAGTGTTGCCCTGAGCAGGG - Exonic
1174642380 20:52055772-52055794 ACCCAGTTTTTGCCTGGGCATGG + Intronic
1175117189 20:56690934-56690956 CCACAGTGTAGTCATGGGCTGGG - Intergenic
1175183155 20:57162467-57162489 CCCCAGACTAGGGCTGGCCAGGG + Intergenic
1175192964 20:57223894-57223916 CCCCAGGAGAGGACTGGGCAAGG + Intronic
1175776734 20:61658594-61658616 CACCAGTGTGGCCCTGGGCAGGG + Intronic
1175800996 20:61800930-61800952 ACATAGGGTAGGCCTGGGCATGG + Intronic
1176069119 20:63216824-63216846 CCCCAGCCTAGGCCGGGCCAGGG + Intergenic
1176095762 20:63343684-63343706 CCCCAGTGAAGGCCCTGGCCAGG - Intronic
1176117417 20:63439164-63439186 CCCCAGGGCAGGGCAGGGCAGGG - Intronic
1179600806 21:42476197-42476219 GCCCAGCCTAGGCCTGGCCAGGG + Intronic
1179977487 21:44877058-44877080 TCTCAGTGTAGCCCTGAGCATGG - Intergenic
1181286053 22:21753463-21753485 CGGCAGTGGAGGCCTGGCCAGGG + Intergenic
1181715264 22:24722370-24722392 CAGCAGTGTGGGGCTGGGCACGG - Intronic
1182176173 22:28291556-28291578 GCCCAGTGTTGGCCAAGGCAGGG + Intronic
1182900634 22:33895438-33895460 GCTCAGTGTGAGCCTGGGCATGG + Intronic
1183292501 22:37011313-37011335 CCCGAGTCCAGTCCTGGGCAGGG + Exonic
950307609 3:11928474-11928496 CCGCAGTGTAGAACTGAGCAAGG + Intergenic
953391870 3:42538596-42538618 CACCACTGTTGGTCTGGGCAGGG - Intergenic
953926039 3:46982864-46982886 CCCCAGGGTAGGCATAGGAAGGG + Intronic
956199492 3:66691707-66691729 GCCCAGTGAAGGCTGGGGCAGGG - Intergenic
956770321 3:72520430-72520452 CCCCATTGTAGGCCAAGGGATGG - Intergenic
956811935 3:72871903-72871925 CTCCAGTATAGGCCTTGGAATGG - Intergenic
961508738 3:127388475-127388497 CCCCAGCCTGGGCCTGGCCAAGG + Intergenic
961602484 3:128072340-128072362 CCCCAGGGCAGGCCTGACCAGGG + Intronic
962068667 3:132010612-132010634 CCCCAGTGATGGCCCGGTCAGGG + Intronic
962809571 3:138949116-138949138 CCCCAGCCAGGGCCTGGGCAGGG + Intronic
962834383 3:139173983-139174005 CCACAGGCTAGGGCTGGGCAGGG - Intronic
964284351 3:155101421-155101443 CCCCAGTGAGTGCCTGGGCCTGG - Intronic
966208359 3:177427492-177427514 CCCCAGGGTTGGACTGGGTAGGG + Intergenic
967194455 3:187014475-187014497 CCCCAGTGCTGGCCTGGGAAAGG - Intronic
967373622 3:188776208-188776230 CCCCACTGTAGGATGGGGCATGG - Intronic
968040312 3:195583211-195583233 CCACAGTGTAAGCCTAGGCCTGG + Intronic
968235182 3:197027182-197027204 CCCCAGTGTGGGCCTGTGATTGG + Intronic
968578992 4:1380982-1381004 CGCCCGGGTAGGTCTGGGCAAGG + Exonic
968647699 4:1748671-1748693 CCCCAAGGAAGGCCTGGGCTCGG - Intergenic
968701856 4:2061231-2061253 CCTCAGGGCAGGCCTGGGCGAGG + Intronic
968750732 4:2387559-2387581 GCACAGAGGAGGCCTGGGCAGGG + Intronic
968966155 4:3769995-3770017 CCCCCGACCAGGCCTGGGCAGGG + Intergenic
969055187 4:4397276-4397298 ACCCAGTGCATGCCTGGGCTTGG + Intronic
969973565 4:11073677-11073699 CGCCTGTGTAGGCCTTGGCGTGG - Intergenic
972131101 4:35834315-35834337 ACCTAGTGAAGGGCTGGGCATGG - Intergenic
985575426 5:671408-671430 CCCCAGTCTCGGCCTGGGCAGGG + Intronic
986213346 5:5694939-5694961 CCCCAGTGGAGGTGGGGGCATGG - Intergenic
987134443 5:14887744-14887766 CTCCAGAGTAGCCCTGGGCATGG - Intergenic
988458196 5:31406899-31406921 CCACAGTGTAGGTTCGGGCATGG + Exonic
995212577 5:109557490-109557512 CCCCAGGGCTGGCATGGGCAAGG + Intergenic
997431525 5:133844312-133844334 CCCCTGTGCAGGCCTGGGAGTGG - Intergenic
997539210 5:134647754-134647776 CCACTGTGTCGGGCTGGGCAAGG - Intronic
997645405 5:135478198-135478220 CCCCAGTGTGGGCCTGGAATGGG + Intergenic
997883485 5:137611329-137611351 CCACTGTGAAGCCCTGGGCAGGG - Intergenic
997883714 5:137612704-137612726 TCCCAGAATAGGGCTGGGCAGGG - Intergenic
998911613 5:146966364-146966386 CCCCAGTATCTCCCTGGGCATGG - Intronic
999495963 5:152097224-152097246 CCCCACAAAAGGCCTGGGCAGGG + Intergenic
1001154141 5:169258428-169258450 TCCCAGTGAAGTCCTGGCCAAGG + Intronic
1001290215 5:170451950-170451972 CACCAGCCCAGGCCTGGGCAGGG - Intronic
1002473249 5:179450109-179450131 CCCCAGTGAAGGCCCGGCCTGGG - Intergenic
1002570107 5:180135390-180135412 CCGCAGAGTAGGTCTGGACATGG - Intronic
1003936086 6:10976684-10976706 CCTGAGTGTAGGGCTGGGAATGG - Intronic
1005431066 6:25757567-25757589 CTCCAGTTTGGGCCTGGGGAGGG + Intronic
1006722412 6:36165447-36165469 CACCAGTGTCAGGCTGGGCAAGG + Intergenic
1008093461 6:47315338-47315360 CCCCGGTTTAGACCTGGGCCCGG + Intergenic
1009411543 6:63370666-63370688 CCCCAGCTGAGGCCTGGGCAGGG + Intergenic
1011084082 6:83519757-83519779 CCCAAGGGTAGACGTGGGCATGG + Intronic
1015923710 6:138289909-138289931 CCTCAGCGTAGGCCTGGAGATGG + Exonic
1016392813 6:143591962-143591984 CCCGAGGGTTAGCCTGGGCATGG + Intronic
1017765654 6:157604832-157604854 GCACTGTGTAGGGCTGGGCATGG - Intronic
1017953004 6:159153022-159153044 CCACACTGGAGGCCTTGGCAAGG - Intergenic
1019380304 7:718219-718241 CCCCAGTGAAGGCCTGGGGCCGG - Intronic
1019440676 7:1044701-1044723 CCCCAGTCTCCGCCTGGGGAGGG + Intronic
1019481197 7:1267578-1267600 CCCCAGAGCAGCCCTGGGCTGGG + Intergenic
1019512382 7:1424174-1424196 ACCCAGTGCAGGCCTGGGGAGGG + Intergenic
1019831028 7:3330680-3330702 ACCCAGTCTAGGGCTAGGCACGG + Intronic
1021905203 7:25326549-25326571 CCCCAGTGGAGGGCTGGGGACGG + Intergenic
1022333251 7:29399669-29399691 CACCATTGTGGGCCTGGGAAGGG - Intronic
1023843087 7:44107574-44107596 CCCCAGAGTAGGCCTGGGTGGGG + Intronic
1023844407 7:44112842-44112864 CGCCGGTGTAGTCCTGGGCTTGG - Exonic
1026802932 7:73411159-73411181 CCCCAGTGCCAGCCTGGGCTTGG - Intergenic
1027219762 7:76206472-76206494 CCACAGTGAAGGCCTAGGCTGGG - Intronic
1027236089 7:76298767-76298789 CCCGATTCTGGGCCTGGGCAGGG + Intergenic
1028477500 7:91266840-91266862 CCCCGGCCGAGGCCTGGGCATGG - Exonic
1029710024 7:102294448-102294470 CCCATGTGCAGGCATGGGCAGGG - Intronic
1030064916 7:105652206-105652228 CAGCAGTGTAGCCTTGGGCAGGG + Intronic
1030066015 7:105659781-105659803 CATCAGTGTAGACGTGGGCATGG - Intronic
1030286008 7:107827463-107827485 GCCCAGTGAAGGCCAAGGCAGGG - Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1033210571 7:139457215-139457237 GCCCAGGGTGGGGCTGGGCAGGG + Intronic
1033370801 7:140705712-140705734 CACCACTGTAGGCCTGTGCTTGG - Intronic
1035358377 7:158293789-158293811 GCCCTGTGTAGGCCTAGGCTAGG - Intronic
1038425533 8:27461825-27461847 CCCCAGTGGCCGCCTGTGCAGGG - Intronic
1039440840 8:37594349-37594371 TCCCAGAGTAGGCCTGGCCTTGG - Intergenic
1039762776 8:40595791-40595813 CCGCAATGTAAGGCTGGGCACGG + Intronic
1045551846 8:103180015-103180037 CCACAGTGCAGGCCTGGGCCAGG + Intronic
1047448367 8:124939583-124939605 CCCCATTTTTGGTCTGGGCATGG + Intergenic
1048328228 8:133454699-133454721 CCCCAGCGTAGGCCTTGGAGAGG - Intergenic
1048550047 8:135425729-135425751 TCATAGTGTAGGCCTGGGTAAGG + Intergenic
1049108912 8:140630652-140630674 CCCCAGTGTTGGGTTGGGAATGG - Intronic
1049323626 8:142010583-142010605 CCCCTGTCCAGGCCTGGGCCGGG + Intergenic
1049756801 8:144314368-144314390 CCCCAGTGCAGGGCTGGTCTTGG + Exonic
1056257639 9:84816488-84816510 GCCCAGTGTTGGGCTGGGCGTGG + Intronic
1056534643 9:87516952-87516974 CTCCAGTGCAGCCCTAGGCATGG - Intronic
1056880407 9:90386669-90386691 CCGCAGGGTAGACTTGGGCAAGG + Intergenic
1058387762 9:104459062-104459084 CCTCGGTTTTGGCCTGGGCATGG - Intergenic
1059407161 9:114108401-114108423 CCCGAGAGTAAGCCAGGGCAGGG - Intergenic
1059699922 9:116765295-116765317 CCCCAGAGTCGGGCTAGGCAAGG + Intronic
1060280094 9:122209832-122209854 CTCCTGGGTAGCCCTGGGCAAGG + Intronic
1061281067 9:129597813-129597835 CCCCAGAGGAGTCCTGGGCAGGG - Intergenic
1061861321 9:133470016-133470038 CCCCAGGGCAGTACTGGGCAGGG - Exonic
1062127245 9:134870349-134870371 GCCGAGTGTAGACCTGGGCATGG + Intergenic
1062262085 9:135667796-135667818 CCCCAGAGGAGGCCTGGGCATGG + Intergenic
1189381711 X:40506934-40506956 CCCCAGGGTGGGCCTGGGACAGG - Intergenic
1189443830 X:41062119-41062141 CTCCATTGTGGGGCTGGGCACGG + Intergenic
1190741093 X:53289260-53289282 CCCAAATGGAGGCCTGTGCATGG + Intronic
1192072086 X:67951749-67951771 CCCCAGTTCAGGACTGGGCAAGG - Intergenic
1194283403 X:91980723-91980745 CTCCAGTTTGGGGCTGGGCATGG - Intronic
1196134099 X:112188399-112188421 GCCCAGTGTCTGCCTGGGGATGG - Intergenic
1200108443 X:153726798-153726820 CCGCAGTGGCGGCCTGGGCCCGG - Intronic
1200224241 X:154408469-154408491 CCCCAGTGGTGGCAGGGGCATGG - Intronic
1200600976 Y:5205257-5205279 CTCCAGTTTGGGGCTGGGCATGG - Intronic