ID: 1108072925

View in Genome Browser
Species Human (GRCh38)
Location 13:46647949-46647971
Sequence CTTTTCCCCAGACCGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 0, 2: 7, 3: 72, 4: 530}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108072916_1108072925 14 Left 1108072916 13:46647912-46647934 CCTTTTTGGCACCAGGGACCGGT 0: 149
1: 1181
2: 1479
3: 1023
4: 537
Right 1108072925 13:46647949-46647971 CTTTTCCCCAGACCGGGGTGGGG 0: 1
1: 0
2: 7
3: 72
4: 530
1108072913_1108072925 19 Left 1108072913 13:46647907-46647929 CCCAACCTTTTTGGCACCAGGGA 0: 956
1: 1606
2: 1390
3: 917
4: 585
Right 1108072925 13:46647949-46647971 CTTTTCCCCAGACCGGGGTGGGG 0: 1
1: 0
2: 7
3: 72
4: 530
1108072918_1108072925 3 Left 1108072918 13:46647923-46647945 CCAGGGACCGGTTTTGTGGAAGA 0: 87
1: 639
2: 1049
3: 1537
4: 1277
Right 1108072925 13:46647949-46647971 CTTTTCCCCAGACCGGGGTGGGG 0: 1
1: 0
2: 7
3: 72
4: 530
1108072919_1108072925 -4 Left 1108072919 13:46647930-46647952 CCGGTTTTGTGGAAGACAGCTTT 0: 2
1: 112
2: 452
3: 737
4: 1147
Right 1108072925 13:46647949-46647971 CTTTTCCCCAGACCGGGGTGGGG 0: 1
1: 0
2: 7
3: 72
4: 530
1108072914_1108072925 18 Left 1108072914 13:46647908-46647930 CCAACCTTTTTGGCACCAGGGAC 0: 923
1: 1683
2: 1429
3: 952
4: 599
Right 1108072925 13:46647949-46647971 CTTTTCCCCAGACCGGGGTGGGG 0: 1
1: 0
2: 7
3: 72
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108072925 Original CRISPR CTTTTCCCCAGACCGGGGTG GGG Intronic
900305825 1:2007196-2007218 CTGTTCCCCAGACTGGAGTGCGG + Intergenic
901578984 1:10224891-10224913 TTTTTCCACAGACAGGGTTGGGG + Intronic
901618789 1:10564471-10564493 CTCTTGCCCAGACTGGAGTGTGG + Intronic
901895286 1:12306749-12306771 TTTTTCCACAGACAGGGTTGGGG + Intronic
902059691 1:13631646-13631668 CTGTTGCCCAGGCTGGGGTGCGG - Intergenic
902607853 1:17579055-17579077 CTGTTTCCCAGACTGGAGTGCGG + Intronic
902945049 1:19829785-19829807 CTGTTGCCCAGGCTGGGGTGTGG + Intergenic
903088360 1:20884898-20884920 TTTTTCCACAGACCAGGGTTGGG + Intronic
903356217 1:22749438-22749460 CATGTGCCCAGACCTGGGTGAGG - Intronic
903673334 1:25049459-25049481 CTTACCCCCAAACCAGGGTGTGG - Intergenic
903703867 1:25270560-25270582 TTTTTCCATGGACCGGGGTGAGG - Intronic
903723375 1:25422764-25422786 TTTTTCCATGGACCGGGGTGAGG + Intronic
903791317 1:25895137-25895159 CTGTTGCCCAGACTGGAGTGCGG + Intronic
904001874 1:27343321-27343343 GTTCTCCCCAGACCAGGCTGGGG - Intronic
904066393 1:27755195-27755217 CTTCTCCCCAGACCTGGCTCTGG + Exonic
904353054 1:29921374-29921396 TTTTTCCACAGACGGGGGTGGGG + Intergenic
904551952 1:31325954-31325976 CTCTTACCCAGGCTGGGGTGCGG - Intronic
905635020 1:39545134-39545156 CTATTGCCCAGACTGGAGTGTGG + Intergenic
905685551 1:39904995-39905017 CTGTTGCCCAGACTGGAGTGCGG + Intergenic
905688946 1:39928647-39928669 TTTTTCCACAGACTGGGGTGCGG - Intergenic
905788788 1:40779078-40779100 CTTTTCCCCAGATCTGGGTGTGG - Intergenic
905998260 1:42401035-42401057 TTTTTCCACAGATGGGGGTGGGG + Intronic
906327952 1:44860036-44860058 CTGTCCCCCAGACTGGAGTGCGG + Intronic
906390500 1:45411313-45411335 TTTTTCCACAGACTCGGGTGAGG + Intronic
906405579 1:45539412-45539434 CTGTTGCCCAGACTGGAGTGTGG + Intergenic
907033352 1:51194353-51194375 CTGTCACCCAGACTGGGGTGCGG + Intergenic
908237622 1:62162221-62162243 CTTTTCCTAAGACCGAGGGGTGG - Exonic
908535266 1:65071041-65071063 CTTATTCCCAGCCCTGGGTGGGG + Intergenic
911903125 1:103530062-103530084 TTTTTCCACAGGCTGGGGTGGGG - Intronic
912092307 1:106095015-106095037 CTGTTCCCCAGGCTGGAGTGTGG + Intergenic
912395551 1:109340110-109340132 CTGTTGCCCAGACTGGAGTGCGG - Intronic
915962076 1:160275282-160275304 GTTTTCCACAGAGGGGGGTGGGG - Intergenic
916619212 1:166477564-166477586 TTTTTCCACAGAGTGGGGTGGGG + Intergenic
917850621 1:179060632-179060654 ATTTTCCACAGACAGGGGTTGGG - Intronic
918400104 1:184154392-184154414 CTTTTACCCAGGGAGGGGTGAGG - Intergenic
918730722 1:187992521-187992543 CTTTTCTCTAGACCAGGGTGAGG + Intergenic
919153600 1:193732036-193732058 CTTTTCCAAGGACCAGGGTGGGG + Intergenic
919949915 1:202353644-202353666 CTGTTACCCAGACTGGAGTGTGG + Intronic
920580128 1:207098581-207098603 CTTTTCCACGGATGGGGGTGGGG + Intronic
921322423 1:213954907-213954929 TTTTTCCACAGACCGGGGTGGGG + Intergenic
922094500 1:222431408-222431430 CTTTTACCCAGGCTGGAGTGCGG - Intergenic
922111827 1:222566349-222566371 TTTTTCCACAGACCAGTGTGAGG + Intronic
922501686 1:226101596-226101618 TTTTTCCACAGACTGGGGTAAGG - Intergenic
924151459 1:241134657-241134679 CTTTTTCCCAGAGAGGGGAGGGG + Intronic
1063249794 10:4262038-4262060 CTTTTGCCCAGGCTGGAGTGCGG + Intergenic
1063435376 10:6025315-6025337 CTGTTGCCCAGGCTGGGGTGCGG - Intronic
1063462686 10:6224515-6224537 CTGTTCCCCAGGCTGGAGTGCGG + Intronic
1063494766 10:6496709-6496731 CTGTTGCCCAGACTGGAGTGCGG + Intronic
1063499456 10:6539680-6539702 TTTTTCCACAGACTGGGGTGGGG - Intronic
1064164210 10:12972778-12972800 CTTTTACCCAGGCTGGAGTGCGG - Intronic
1064368154 10:14726810-14726832 TTTTTCCACAGACCAGGGTGTGG + Intronic
1064449901 10:15432312-15432334 TTTTTCCACAGACCGGTGGGCGG - Intergenic
1064684805 10:17849263-17849285 CTATTCCCCAGGCCAGAGTGCGG - Intronic
1064850328 10:19702283-19702305 CTTTTCCCAAGAGTAGGGTGTGG - Intronic
1065631417 10:27684789-27684811 TTTTTCCACAGACCGGGGAGCGG + Intronic
1065939563 10:30551759-30551781 TTTTTCCACAGACTGGGGTGGGG + Intergenic
1066383055 10:34918148-34918170 CTCTTCCCCAGAGGTGGGTGTGG - Intergenic
1066560149 10:36661089-36661111 CTGTTGCCCAGGCTGGGGTGCGG - Intergenic
1067221672 10:44348361-44348383 CCTTTCCACAGACCCCGGTGAGG - Intergenic
1067404058 10:46004351-46004373 CTGTTCCCCAGGCTGGAGTGCGG + Intergenic
1068194130 10:53694380-53694402 TTTTTCCACAGACGGGGGTAGGG + Intergenic
1068883671 10:62076523-62076545 CTGTAGCCCAGACCGGAGTGCGG - Intronic
1069136509 10:64773160-64773182 TTTTTCCTCAGACAGGGGTGGGG - Intergenic
1069358367 10:67613838-67613860 CTTTTCCACAGACCCAGGGGTGG + Intronic
1069407190 10:68114376-68114398 CTTTTGCCCAGACTGGAGTGTGG + Intronic
1070187850 10:74083726-74083748 CTGTTACCCAGACTGGAGTGCGG + Intronic
1070942992 10:80362940-80362962 CTTTTCCCTATTCTGGGGTGAGG - Exonic
1071562590 10:86655491-86655513 CTCTTCCCCAGAAAGGGGTTAGG + Intronic
1072098040 10:92201489-92201511 CTGTTGCCCAGACTGGAGTGCGG - Intronic
1072322431 10:94263655-94263677 CTGTTACCCAGACTGGTGTGCGG - Intronic
1072332697 10:94369234-94369256 TTTTTCCACAGATCAGGGTGGGG + Intergenic
1072488605 10:95880703-95880725 CTTTTTCCCAGACCCATGTGTGG + Intronic
1072574428 10:96687217-96687239 CTTTTGCCCAGGCCGGACTGCGG - Intronic
1072968424 10:99995087-99995109 CTGTTGCCCAGACTGGAGTGCGG + Intronic
1075848223 10:125564454-125564476 CTTTTCCACAGGCTGGGGAGGGG + Intergenic
1076057372 10:127386768-127386790 TTTTTCCATGGACCGGGGTGGGG - Intronic
1076314219 10:129529317-129529339 CTTTTCCACAGATGGGAGTGGGG + Intronic
1076417652 10:130302895-130302917 CTTTTGCCCAGGCTGGAGTGCGG + Intergenic
1077528031 11:3079741-3079763 CTGTTGCCCAGACTGGGGTGCGG - Intergenic
1077618988 11:3702199-3702221 CTGTTTCCCAGGCTGGGGTGCGG - Intronic
1077643423 11:3902418-3902440 TTTTTCCACAGACCAGGGTGCGG + Intronic
1078236701 11:9491599-9491621 CTGTTCCCCAGGCTGGAGTGAGG - Intronic
1078342775 11:10511416-10511438 TTTTTCCACAGACCAGGGTTGGG - Intergenic
1080242877 11:30147242-30147264 TTTTTCCACAGATGGGGGTGGGG + Intergenic
1080466494 11:32502370-32502392 TTTTTCCACAGACCAGGGGGTGG - Intergenic
1080538913 11:33248079-33248101 CTGTTGCCCAGACTGGAGTGCGG + Intergenic
1080878526 11:36298252-36298274 TTTTTCCACAGACCAGGGTAGGG + Intronic
1081475094 11:43421845-43421867 CTTTTCCAAAGACTGGGGGGTGG - Intronic
1081900334 11:46622152-46622174 CTGTTTCCCAGACTGGAGTGCGG + Intronic
1083227499 11:61294352-61294374 CTTTCCCCCGGGCCGCGGTGGGG - Intronic
1083576676 11:63796900-63796922 TTTTTCCACAGACAGGGTTGGGG + Intergenic
1083628507 11:64084204-64084226 CTTTGCCCCAGGCCTGGGAGGGG - Intronic
1084685035 11:70688305-70688327 CTTGGCCCCAGACCAAGGTGAGG - Intronic
1085306798 11:75490868-75490890 CTTTTCCCAATTCCTGGGTGGGG - Intronic
1087379893 11:97391786-97391808 CTTTTGCCCAGGCTGGAGTGCGG - Intergenic
1087454850 11:98372113-98372135 TTTTTCCACAGACCAGGGTTGGG + Intergenic
1087706596 11:101500243-101500265 CTGTTGCCCAGACTGGAGTGCGG + Intronic
1088075199 11:105839669-105839691 CTGTTGCCCAGGCTGGGGTGCGG - Intronic
1088424909 11:109692744-109692766 CTTTTCCCCACAACAGGGTGTGG - Intergenic
1089181389 11:116585386-116585408 TTTTTCCACAGACCAGGGTGGGG - Intergenic
1089386006 11:118068511-118068533 CTTTTACAGAGACGGGGGTGAGG + Intergenic
1090330764 11:125930479-125930501 CTTTTCCACGGACAGGGGTGTGG - Intergenic
1090704825 11:129326689-129326711 TTTTTCCACAGACCAGGGGGTGG + Intergenic
1091541612 12:1467590-1467612 TTTTTCCACAGACAGGGGAGTGG + Intronic
1091942606 12:4501818-4501840 GTTTTCCACAGACCGGGGGTTGG - Intronic
1092600575 12:10058565-10058587 CTGTTGCCCAGGCCGGAGTGCGG + Intronic
1093176365 12:15917734-15917756 TTTTTCCACAGACTGGGGTAGGG + Intronic
1093224537 12:16465777-16465799 TTTTTCCACAGATTGGGGTGGGG - Intronic
1095214287 12:39529637-39529659 CTGTTACCCAGACTGGAGTGTGG + Intergenic
1096163901 12:49404321-49404343 CTGTTGCCTAGACTGGGGTGTGG + Intronic
1096188236 12:49598021-49598043 CTTTTGCCCAGGCTGGAGTGCGG - Intronic
1096403812 12:51328178-51328200 ATTTTCCACGAACCGGGGTGGGG + Intergenic
1096739247 12:53680020-53680042 CTGTTACCCAGGCTGGGGTGCGG + Intergenic
1097006485 12:55922578-55922600 CTGTTGCCCAGACTGGAGTGCGG - Intronic
1097112839 12:56674787-56674809 CTGTTGCCCAGGCTGGGGTGCGG - Intronic
1097637991 12:62145448-62145470 TTTTTCCACGGACGGGGGTGCGG - Intronic
1097665965 12:62477460-62477482 CTGTTGCCCAGGCCGGAGTGTGG + Intronic
1098606706 12:72399173-72399195 TTTTTCCACAGACAGAGGTGGGG - Intronic
1098723663 12:73934023-73934045 CTTTTGCCCAGGCTGGAGTGTGG - Intergenic
1099747994 12:86732311-86732333 TTTTTTCACAGACCGGGGTGGGG + Intronic
1099827160 12:87791605-87791627 TTTTTTCCCATACTGGGGTGAGG + Intergenic
1100324817 12:93530951-93530973 TTTTTCCACAGACTGGGGTTGGG + Intergenic
1101352784 12:103948067-103948089 CTTTTGCCCAGGCTGGAGTGTGG + Intronic
1101955899 12:109212297-109212319 TTTTTCCACGGACCGGGGAGGGG + Intronic
1102919374 12:116780286-116780308 TTTTTCCACAGATCAGGGTGGGG + Intronic
1103353868 12:120305128-120305150 CTGTTGCCCAGGCTGGGGTGTGG - Intronic
1103609610 12:122114780-122114802 CTGTTGCCCAGACTGGAGTGCGG + Intronic
1103712122 12:122920426-122920448 CTTTTCCCTAGACTGGGGACAGG - Intergenic
1104634731 12:130430665-130430687 CTGTTGCCCAGACTGGAGTGTGG + Intronic
1104650638 12:130529742-130529764 GTTTTCCACAGACTGGGGTGGGG + Intronic
1104680290 12:130746482-130746504 TTTTCCCACAGACCGAGGTGGGG + Intergenic
1104803467 12:131570259-131570281 CTGTTCTCCAGGCAGGGGTGGGG + Intergenic
1105303646 13:19155041-19155063 CCCTTCTCCAGACAGGGGTGGGG + Intergenic
1105711327 13:23011992-23012014 CTGTTGCCCAGACTGGAGTGCGG - Intergenic
1105983977 13:25547668-25547690 TTTTTCCACAGACTTGGGTGGGG - Intronic
1106039879 13:26079728-26079750 CTCTTCCTCAGATCTGGGTGTGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107593606 13:41937192-41937214 TTTTTCCACAGACTGGGGGGAGG + Intronic
1108072925 13:46647949-46647971 CTTTTCCCCAGACCGGGGTGGGG + Intronic
1108298981 13:49055138-49055160 CTGTTGCCCAGGCTGGGGTGCGG + Intronic
1108515182 13:51194785-51194807 CTTTTCCACAGACTGGAGTAGGG + Intergenic
1108613090 13:52103392-52103414 CTGTTGCCCAGACTGGAGTGCGG - Intronic
1109176702 13:59166574-59166596 TTTTTCCACAGACTGGGGGGTGG - Intergenic
1109218553 13:59617211-59617233 CTGTTTCTCAGACCTGGGTGTGG - Intergenic
1109727151 13:66356990-66357012 CATTTCCCCATACCAGTGTGTGG + Intronic
1113798174 13:113071039-113071061 CCTTTCCCCAGCACGTGGTGGGG + Intronic
1113881235 13:113627825-113627847 TTTTTCCACAGACCGGAGTCGGG - Intronic
1113932165 13:113974256-113974278 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1113932193 13:113974350-113974372 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1114305920 14:21422890-21422912 CTGTTTCCCAGGCTGGGGTGCGG - Intronic
1114890422 14:26914884-26914906 CTTTTCCACATTCTGGGGTGAGG + Intergenic
1115215852 14:31013334-31013356 CTTTTGCCCAGGCTGGAGTGTGG - Intronic
1115461182 14:33662895-33662917 CTGTTGCCCAGACTGGAGTGCGG + Intronic
1116628672 14:47300524-47300546 CTGTTGCCCAGACTGGAGTGTGG + Intronic
1116691834 14:48117619-48117641 CTATTACCCAGACTGGAGTGTGG + Intergenic
1116887152 14:50232062-50232084 CTTTTCCCGAGACTGTGCTGGGG + Intergenic
1117621867 14:57595476-57595498 CTCTTCCCCACACCAGAGTGTGG - Intronic
1118187975 14:63554778-63554800 TTTTTCCACTGACTGGGGTGTGG + Intergenic
1118620719 14:67611760-67611782 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1119224602 14:72935289-72935311 CTTTTGCCCAGGCTGGAGTGCGG + Intronic
1120635681 14:86948151-86948173 GTTTTCCACAGACTGGGGGGAGG + Intergenic
1121127569 14:91417863-91417885 CCTTCCCCCAGACCCGGGCGGGG - Intergenic
1121284994 14:92728182-92728204 TTTTTCCACACACAGGGGTGAGG + Intronic
1121736343 14:96220664-96220686 CATCTCCCCAGACCTGGCTGAGG + Intronic
1122468635 14:101950959-101950981 ATATTCCACAGACCAGGGTGGGG - Intergenic
1122533709 14:102447189-102447211 CTTTTGCCCACACTGGAGTGTGG + Intronic
1122964552 14:105116168-105116190 CTATTTCCCAGGCCGTGGTGAGG + Intergenic
1123666682 15:22613887-22613909 CTATTCCCCAGACCAGGAAGCGG + Intergenic
1124015885 15:25875361-25875383 CTGTTGCCCAGGCCAGGGTGCGG + Intergenic
1124133020 15:27006874-27006896 CTGTTGCCCAGGCCGGAGTGTGG + Intronic
1124320524 15:28708460-28708482 CTATTCCCCAGACCAGGAAGCGG + Intronic
1124481971 15:30086889-30086911 CTATTCCCCAGACCAGGAAGCGG - Intronic
1124487556 15:30132853-30132875 CTTTTGCCCAGGCTGGAGTGCGG - Intergenic
1124488427 15:30138987-30139009 CTATTCCCCAGACCAGGAAGCGG - Intronic
1124542645 15:30601831-30601853 CTTTTGCCCAGGCTGGAGTGCGG - Intergenic
1124543516 15:30607961-30607983 CTATTCCCCAGACCAGGAAGTGG - Intronic
1124755100 15:32399333-32399355 CTATTCCCCAGACCAGGAAGCGG + Intronic
1124755972 15:32405472-32405494 CTTTTGCCCAGGCTGGAGTGCGG + Intergenic
1124777023 15:32597382-32597404 CTATTCCCCAGACCAGGAAGCGG - Intronic
1124917866 15:33994507-33994529 TTTTTCCACAGACCAGGGTGAGG - Intronic
1125661219 15:41396343-41396365 CTTATCCCCAGACACAGGTGAGG + Intronic
1126164961 15:45647210-45647232 CTGTTGCCCAGACTGGAGTGCGG - Intronic
1126524118 15:49631160-49631182 TTTTTCCACAGACCAGGGTTTGG - Intronic
1126704214 15:51392590-51392612 TTTTTCCATAGACCGGGGTGTGG - Intronic
1126758111 15:51943661-51943683 CTGTTGCCCAGGCAGGGGTGCGG - Intronic
1126889778 15:53192215-53192237 CTGTTGCCCAGACTGGAGTGTGG - Intergenic
1127271217 15:57403581-57403603 CTTTTCCCCACAAAGGGCTGCGG - Intronic
1127424147 15:58838621-58838643 CTGTTGCCCAGACTGGAGTGCGG + Intronic
1127477369 15:59347340-59347362 CTTTTCTGCAGCCTGGGGTGTGG - Intronic
1127773896 15:62251082-62251104 CTATTCCCCAGACCAGGAAGCGG + Intergenic
1128093123 15:64932401-64932423 CTTTTCCCCTGACAGAGCTGGGG + Intronic
1128171017 15:65513248-65513270 CTGTTACCCAGACTGGAGTGCGG + Intronic
1128295439 15:66514976-66514998 CTTTTGCCCAGGCTGGAGTGTGG + Intronic
1128664734 15:69529824-69529846 TATGTCCCCAGACAGGGGTGGGG + Intergenic
1128969627 15:72096299-72096321 CTGTTGCCCAGGCCGGAGTGCGG - Intronic
1129029532 15:72608385-72608407 CTATTCCCCAGACCAGGAAGCGG - Intergenic
1129037476 15:72659424-72659446 CTATTCCCCAGACCTGGAAGCGG - Intronic
1129161147 15:73748667-73748689 CTTTTCTCCAAACCGGGGTCTGG + Intronic
1129212411 15:74077801-74077823 CTATTCCCCAGACCTGGAAGCGG + Intronic
1129279200 15:74470518-74470540 TTTTTCCACAGACCAGGGTAGGG + Intergenic
1129397987 15:75263278-75263300 CTATTCCCCAGACCTGGAAGCGG - Intronic
1129401598 15:75287559-75287581 CTATTCCCCAGACCTGGAAGCGG - Intronic
1129406255 15:75320564-75320586 TTTTTCCACAGACGGGGTTGGGG - Intergenic
1129729545 15:77922120-77922142 CTATTCCCCAGACCTGGAAGTGG + Intergenic
1129735217 15:77957055-77957077 TTTTTCCACAGACGGGGTTGGGG + Intergenic
1130195731 15:81778701-81778723 TTTTTCCACAGACCAGGGCGGGG + Intergenic
1130458588 15:84140289-84140311 CTGTTGCCCAGACTGGAGTGTGG - Intergenic
1131679911 15:94710498-94710520 CTTTCTCCCAGGCCGGAGTGCGG + Intergenic
1132433402 15:101778289-101778311 CTATTCCCCAGACCAGGAAGTGG + Intergenic
1133014286 16:2932079-2932101 CTTTTGCCCAGGCTGGAGTGCGG - Intronic
1133774014 16:8884146-8884168 GTTTCCTCCAAACCGGGGTGGGG + Intergenic
1133909338 16:10050727-10050749 TTTTTCCACAGACCGGGGTTGGG - Intronic
1134112748 16:11525321-11525343 CATTTCCCCAAAACGGGGAGGGG + Intergenic
1135868271 16:26125269-26125291 TTTTTCCACAGATGGGGGTGGGG + Intronic
1136988899 16:35140136-35140158 ATTTTCCGCAGACCAGCGTGAGG - Intergenic
1137455256 16:48613073-48613095 CTTTTCCCCAGAGCAGGAGGAGG + Intronic
1138437559 16:57012689-57012711 TTTTTCCCCGGACGGGGGTTGGG - Intronic
1138437739 16:57014963-57014985 CTGTTGCCCAGACTGGAGTGCGG + Intronic
1138907354 16:61353342-61353364 CTGTTGCCCAGACTGGAGTGCGG - Intergenic
1139533500 16:67556659-67556681 CTGTTGCCCAGGCTGGGGTGTGG - Intergenic
1139572813 16:67823980-67824002 CTTTTGCCCAGGCTGGAGTGCGG - Intronic
1139788387 16:69412565-69412587 CTGTGCTCCAGAGCGGGGTGGGG + Intergenic
1140077604 16:71715957-71715979 CTGTTGCCCAGACTGGAGTGCGG - Intronic
1140679954 16:77375343-77375365 CTTTCACCCAGGCCGGAGTGCGG - Intronic
1140863557 16:79040309-79040331 CTGTTGCCCAGACTGGAGTGCGG + Intronic
1141582296 16:85008077-85008099 CTTTTGCCCAGGCTGGAGTGCGG - Intronic
1141866594 16:86754254-86754276 CTGTTGCCCAGGCTGGGGTGCGG + Intergenic
1142016256 16:87749618-87749640 CTATTGCCCAGACTGGAGTGCGG + Intronic
1142282335 16:89155025-89155047 CTTTTCCCCAGACCCAGCTCCGG + Exonic
1142792439 17:2278009-2278031 CTGTTTCCCAGGCTGGGGTGCGG - Intronic
1143279482 17:5741810-5741832 TTTTTCCACGGACGGGGGTGGGG + Intergenic
1143582472 17:7835078-7835100 CTTTCCCTCGGACCGGGGCGGGG - Intergenic
1143602016 17:7953208-7953230 TTTTTCCACAGACAGGGGTGCGG + Intergenic
1145403005 17:22559026-22559048 CTGTTACCCAGACTGGGATGTGG + Intergenic
1146173241 17:30648740-30648762 TTTTCCCCTAGACCTGGGTGGGG + Intergenic
1146346701 17:32064772-32064794 TTTTCCCCTAGACCTGGGTGTGG + Intergenic
1147339077 17:39743169-39743191 CTTGTCCCCAGAGCGGGGTTTGG + Exonic
1147414168 17:40276482-40276504 CTGTTGCCCAGACTGGGGTGCGG - Intronic
1148136585 17:45296472-45296494 CTGTTGCCCAGACTGGAGTGCGG - Intronic
1148462723 17:47847640-47847662 CTTTCCCGCAGCCCGGGATGTGG + Exonic
1149436856 17:56640475-56640497 CTTTTCCCCCAACCTTGGTGTGG + Intergenic
1149620723 17:58043080-58043102 CCTTTGCTCAGACAGGGGTGTGG + Intergenic
1149933521 17:60780329-60780351 CTGTTGCCCAGACTGGGGTGCGG + Intronic
1150031998 17:61748314-61748336 CTTTTCCACAGACCTGGGTTGGG - Intronic
1150278976 17:63917982-63918004 CTTCTCCCCAGGCGGGGATGGGG - Intronic
1150390198 17:64785687-64785709 CTGTTGCCCAGACTGGTGTGAGG + Intergenic
1150806742 17:68325490-68325512 TTTTTCCACAGACAGGGGTTGGG - Intronic
1150963573 17:69941034-69941056 CTTTTGCCCAGGCTGGAGTGCGG + Intergenic
1151026759 17:70686017-70686039 TTTTTCCACAGACCAGGGTAGGG - Intergenic
1151151031 17:72086955-72086977 CTTTTCCCCAAGCTGGGTTGTGG - Intergenic
1151601977 17:75111407-75111429 CTGTTGCCCAGGCTGGGGTGCGG - Intronic
1151945554 17:77318114-77318136 TTTTTCCACAGACCAGGGAGTGG - Intronic
1151984013 17:77530325-77530347 TTTTTCCACGGACCCGGGTGGGG + Intergenic
1152163347 17:78683619-78683641 ATTTTCCCCAGACAGGAGTGTGG - Intronic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152422327 17:80200617-80200639 CTTTTCCACAGACCGGGTTGTGG + Intronic
1152879544 17:82807301-82807323 CTCTTCCCCTGGCCTGGGTGGGG + Intronic
1152926870 17:83091358-83091380 CTTTCCGCCAGGCAGGGGTGAGG - Intronic
1153377184 18:4393758-4393780 TTTTTCCACAGACCGGGGGCAGG + Intronic
1153897798 18:9583401-9583423 CTTTTGCCCAGGCTGGAGTGAGG + Intronic
1155183884 18:23371129-23371151 CTTTTGCCCAGGCTGGAGTGCGG + Intronic
1156432832 18:37094018-37094040 TTTTTCCACAGACCAGGGTGTGG + Intronic
1157449902 18:47778016-47778038 TTTTTCCGCAGACTGGGGAGGGG + Intergenic
1158289500 18:55923387-55923409 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1158480903 18:57821058-57821080 TTTTTCCACAAACCAGGGTGGGG - Intergenic
1158956377 18:62543622-62543644 CATTTCCCCAGACCGAGGACAGG + Intronic
1159031133 18:63233462-63233484 TTTTTCCATAGACGGGGGTGGGG + Intronic
1159048370 18:63392785-63392807 CTGTTGCCCAGGCTGGGGTGCGG + Intronic
1159558320 18:69967854-69967876 TTTTTCCACAGACCAGGGAGAGG + Intergenic
1160115945 18:76079883-76079905 CTGTCCCCCAGACTGGAGTGCGG + Intergenic
1160625921 18:80204913-80204935 CTTTTGCCCAGGCTGGAGTGCGG - Intronic
1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG + Exonic
1161997419 19:7721984-7722006 CTTTTCCACAGACTGGGGTGGGG + Intergenic
1162053882 19:8051326-8051348 CTTTTGCCCAGGCTGGAGTGCGG - Intronic
1162833262 19:13299846-13299868 TTTTTCCACAGACCTAGGTGTGG + Intronic
1162939595 19:14000759-14000781 CTGTTGCCCAGACTGGAGTGTGG - Intronic
1162989177 19:14291321-14291343 TTTTCCCCTAGACCTGGGTGGGG - Intergenic
1163120966 19:15217469-15217491 TTTTTCCACGGACCGGGGTAGGG + Intergenic
1164707507 19:30331252-30331274 CTGTTCCCCAGGCTGGAGTGTGG - Intronic
1165031924 19:33004073-33004095 CTGTTGCCCAGACTGGAGTGCGG + Intronic
1165096430 19:33412308-33412330 CTTTTGCCCAGGCTGGAGTGCGG - Intronic
1165116108 19:33529756-33529778 CTGTGCCCCAGGCGGGGGTGGGG - Intergenic
1165242477 19:34479902-34479924 TTTTTCCACAGACAGGGATGGGG - Intergenic
1165410407 19:35657044-35657066 TTTTTCCACAGACAGGGTTGGGG + Intronic
1165414082 19:35680637-35680659 CTGTTCCCCAGGCTGGAGTGTGG - Intergenic
1166366657 19:42281420-42281442 CCTGTCCCCAGGCCTGGGTGTGG + Intronic
1166582621 19:43915783-43915805 TTTTTCCACAGACTGGGGTCGGG - Intronic
1166598945 19:44076854-44076876 CTGTTGCCCAGACTGGAGTGTGG + Intronic
1166933671 19:46317873-46317895 CTGTTGCCCAGACTGGAGTGCGG + Intronic
1167024992 19:46909264-46909286 CTGTTCCCCAGGCTGGAGTGCGG - Intergenic
1167124589 19:47540474-47540496 CTGTTGCCCAGACTGGAGTGCGG + Intronic
1167301300 19:48679507-48679529 CTGTTGCCCAGGCTGGGGTGCGG + Intergenic
1167883371 19:52480857-52480879 CTGTCACCCAGACTGGGGTGCGG - Intronic
1168040772 19:53756938-53756960 CTGTTCCCCAGGCTGGAGTGCGG + Intergenic
1168224915 19:54987703-54987725 CTGTTGCCCAGACTGGAGTGCGG - Intronic
1168299918 19:55398736-55398758 CTGTTGCCCAGACTGGAGTGCGG + Intronic
1168400283 19:56081685-56081707 CTTTTGCCCAGGCCGGAGCGCGG + Intergenic
1168603766 19:57741555-57741577 CTTTTCCCCAGACTGGACTGTGG - Intronic
1168692914 19:58387519-58387541 CTTTTCCCCATAGCGGGGCTTGG + Exonic
927132221 2:20070361-20070383 TTTTTCCACGGACAGGGGTGGGG + Intergenic
927170043 2:20361809-20361831 CTGTTTCCCAGGCCGGAGTGCGG - Intergenic
927228062 2:20789875-20789897 TTTTTCCACAGACTGGGGAGGGG - Intronic
927776075 2:25904290-25904312 CTTTTGCCCAGGCTGGAGTGTGG - Intergenic
928154722 2:28866381-28866403 TTTTTCCACAGACTGGGGAGAGG + Intronic
928208569 2:29305756-29305778 CTTTTCCACAGACCAGGGGCTGG + Intronic
929184555 2:39080004-39080026 CTTTTCCACAGACTCGGGTGGGG + Intronic
929675160 2:43919251-43919273 TTTTTCCACAGACCAGGTTGTGG - Intronic
930164547 2:48191264-48191286 CTGTTGCCCAGACTGGAGTGCGG - Intergenic
931046894 2:58363751-58363773 CTGTTGCCCAGGCCGGAGTGCGG - Intergenic
931377297 2:61718882-61718904 TTTCTCCACAGACTGGGGTGGGG - Intergenic
933132625 2:78691256-78691278 CTTTCACCCAGGCTGGGGTGCGG - Intergenic
933290509 2:80433290-80433312 CCCTTCCCCAGACGGGGATGAGG - Intronic
935891315 2:107681806-107681828 TTTTTCCACAGACCAGGGTGGGG + Intergenic
937283775 2:120737172-120737194 CTTTTCCCCGGACGGGGCGGGGG + Intronic
937933106 2:127220425-127220447 CTTTTCCCCAGCCCCAGGGGAGG - Intergenic
939370427 2:141292235-141292257 TTTTTCCACAGACCGGGATGGGG - Intronic
939422961 2:141997517-141997539 CTGTTGCCCAGACTGGAGTGTGG + Intronic
940656673 2:156495311-156495333 CTGTTGCCCAGCCTGGGGTGCGG - Intronic
941169226 2:162117520-162117542 CTGTTGCCCAGCCTGGGGTGTGG + Intergenic
942750401 2:179280018-179280040 CTGTTCCCCAGGCCGGACTGCGG - Intergenic
942892198 2:181004594-181004616 CTCTTCGCCAGACTGGGGTGCGG - Intronic
943937479 2:193938820-193938842 CTGTTCCCCAGGCTGGAGTGTGG - Intergenic
944586570 2:201178652-201178674 CTGTTCCCAACACCAGGGTGTGG + Intergenic
945541811 2:211097447-211097469 CTGTTGCCCAGACTGGAGTGTGG + Intergenic
947482411 2:230512659-230512681 TTTTTCCACAGACCGGGATGGGG + Intronic
948394893 2:237638035-237638057 CTTTTCCACAGACCAGGGTGTGG + Intronic
948535788 2:238645685-238645707 TTTTTCCACAGACCGGGGAAGGG - Intergenic
949081535 2:242104487-242104509 TTTTTCCACAGACTGGGGCGAGG - Intergenic
1169166680 20:3430141-3430163 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1169812541 20:9622788-9622810 TTTTTCCACAGACAGGGGTGCGG - Intronic
1170539451 20:17373418-17373440 CTTTTCCCCAGGCTGTGGGGAGG - Intronic
1170586194 20:17735832-17735854 ATTTTCCCCAGAGGGTGGTGGGG - Exonic
1171768534 20:29303095-29303117 CTTTCGCCCAGACTGGAGTGAGG + Intergenic
1171823376 20:29874946-29874968 CCTTTCCGCAGGCAGGGGTGGGG - Intergenic
1171896721 20:30815362-30815384 CCTTTCAGCAGGCCGGGGTGGGG + Intergenic
1171978326 20:31609422-31609444 CTATTGCCCAGGCTGGGGTGCGG + Intergenic
1172411829 20:34730102-34730124 CTGTCCCCCAGGCTGGGGTGTGG + Intronic
1172717401 20:36975589-36975611 CTGTTGCCCAGACTGGAGTGTGG + Intergenic
1172721950 20:37005930-37005952 CTGTTGCCCAGACTGGAGTGTGG + Intronic
1172757077 20:37293131-37293153 TTTTTCCACAGACCTGGGGGTGG + Intronic
1174244111 20:49163460-49163482 CTGTTGCCCAGACTGGAGTGCGG + Intronic
1174315609 20:49698284-49698306 CTGTCCCCCAGGCCGGAGTGTGG - Intronic
1174455884 20:50648501-50648523 TTTTTCCACTGACCAGGGTGGGG + Intronic
1174635538 20:51996270-51996292 TTTTTCCACAGACTGGGGTTGGG + Intergenic
1174906460 20:54557263-54557285 TTTTTCCACAGACGGGGTTGGGG + Intronic
1175150211 20:56928019-56928041 CATTTCCCCAGATCTGGTTGAGG - Intergenic
1175451910 20:59076559-59076581 CTTTCACCCAGACTGGAGTGTGG + Intergenic
1175495209 20:59409651-59409673 TTTTTCCCCAGACTGTGGAGGGG - Intergenic
1176156022 20:63621158-63621180 CTGTTGCCCAGACTGGAGTGCGG - Intronic
1176308531 21:5137054-5137076 TTTTTCCACAGACAGGGTTGGGG - Intronic
1176972534 21:15283451-15283473 CTTTTCACCAAACTGGAGTGAGG - Intergenic
1177945827 21:27468671-27468693 CTGTCCCCCAGGCCGGAGTGCGG - Intergenic
1179598030 21:42456228-42456250 TTTTTCCACAAACCAGGGTGGGG + Intergenic
1179848528 21:44124978-44125000 TTTTTCCACAGACAGGGTTGGGG + Intronic
1179949427 21:44701391-44701413 CTTTTCCACGGACTGGGGAGGGG + Intronic
1180092837 21:45541840-45541862 CTTTCCTCCAGACCCGGGGGTGG + Intronic
1180886811 22:19251492-19251514 CTTTTGCCCAGGCCGGACTGTGG + Intronic
1181033101 22:20157597-20157619 CATTGCCCCTGACCAGGGTGTGG + Intergenic
1181079460 22:20404364-20404386 CTATTGCCCAGGCTGGGGTGCGG + Intronic
1181647174 22:24238190-24238212 CTGTCCCCCAGGCTGGGGTGTGG - Intronic
1181846829 22:25717009-25717031 TTTTTCCACAGACGGGGATGGGG - Intronic
1182499501 22:30735948-30735970 CTGTTGCCCAGACTGGAGTGTGG + Intronic
1182784595 22:32896965-32896987 CTTTTCTGGAGACCAGGGTGGGG - Intronic
1183327310 22:37201378-37201400 CTGTTGCCCAGACTGGAGTGCGG + Intergenic
1183503664 22:38196444-38196466 CTTTTCCACAGATGAGGGTGGGG + Intronic
1183756555 22:39772107-39772129 TTTTTCCACAGAACAGGGTGTGG + Intronic
1183807391 22:40222778-40222800 CTTTTGCCCAGGCTGGAGTGCGG + Intronic
1184223780 22:43117403-43117425 CTGTCGCCCAGACCGGAGTGTGG + Intronic
1184623851 22:45706100-45706122 TTTTTCCATAGACAGGGGTGGGG - Intronic
1184706305 22:46215942-46215964 TTTTTCCACAGATGGGGGTGGGG - Intronic
1184883445 22:47327054-47327076 TTTTTCTGCAGACCGGGGTGGGG + Intergenic
949510019 3:4759440-4759462 CTTTTGACCACACTGGGGTGTGG - Intronic
949750180 3:7343268-7343290 CTGTTGCCCAGACTGGAGTGCGG + Intronic
949878218 3:8641049-8641071 CATTTCCCCAGCCCTGGCTGGGG + Intronic
950761677 3:15235538-15235560 TTTTTCCACAGACTGGGGGGTGG + Intronic
951055463 3:18142042-18142064 CTTTCGCCCAGGCCGGAGTGCGG - Intronic
951434749 3:22648773-22648795 TTTTTCCATGGACCGGGGTGGGG + Intergenic
951489143 3:23249233-23249255 CTGTTGCCCAGGCTGGGGTGTGG - Intronic
951609780 3:24479263-24479285 CTGTCCCCCAGACTGGAGTGCGG - Intronic
952353386 3:32562224-32562246 CTGTTCCCCAGGCTGGAGTGCGG - Intronic
952881002 3:37986408-37986430 CCTTTCCCAAGGCAGGGGTGAGG + Intergenic
952961002 3:38589026-38589048 CCTTTCCCAAGACCCGGCTGAGG - Intronic
953872561 3:46639952-46639974 TTTTTCCACAGACCAGGGTGGGG + Intergenic
953901363 3:46845875-46845897 TTTGTCCCCGGGCCGGGGTGGGG - Intergenic
953955129 3:47226176-47226198 CTGTTCCCCAGGCTGGAGTGCGG + Intergenic
954510784 3:51123090-51123112 CTTTGCTCCTGACCAGGGTGTGG + Intronic
954725033 3:52601310-52601332 TTTTTCCACAGACAGGGATGGGG + Intronic
954766079 3:52917811-52917833 TTTTTCTACAGACTGGGGTGGGG - Intronic
955251631 3:57288749-57288771 CTGTTGCCCAGACTGGAGTGTGG + Intronic
956198125 3:66674043-66674065 TTTTTCCACAGACCGGGGTGAGG - Intergenic
956592932 3:70934366-70934388 CTATTGCCCAGACTGGAGTGTGG - Intergenic
956764427 3:72472457-72472479 TTTTCCCACAGACCGGGGTTGGG - Intergenic
958056509 3:88419228-88419250 TTTTTCCACAGACCAGGGGGTGG - Intergenic
959181649 3:102987680-102987702 TTTTTCCACGGACAGGGGTGGGG + Intergenic
960086138 3:113593461-113593483 TTTTTCCACAGACGGGGGTGGGG - Intronic
962112021 3:132461726-132461748 CTGTTGCCCAGACTGGAGTGCGG + Intronic
964262863 3:154859432-154859454 CTGTTGCCCAGGCTGGGGTGTGG - Intergenic
964349299 3:155787233-155787255 CTGTTACCCAGACTGGAGTGCGG + Intronic
964349492 3:155788644-155788666 CTGTTGCCCAGACTGGAGTGTGG - Intronic
965427546 3:168546279-168546301 CTGTTGCCCAGGCTGGGGTGCGG + Intergenic
965435753 3:168648896-168648918 TTTTTCCACAGACCGGGGTAAGG - Intergenic
965555030 3:170009845-170009867 CTGTTGCCCAGACGGGAGTGCGG - Intergenic
966358440 3:179107448-179107470 TTTTTCCACAGACTGGGGTAGGG + Intergenic
966426115 3:179781451-179781473 CTTGCCACCAGACCGGGCTGTGG + Intronic
966533659 3:181007790-181007812 TTTTTCCACAGACCGGAGGGAGG - Intergenic
967543019 3:190691223-190691245 CTTTTGCCCAGACTGGAGTTCGG - Intergenic
968037450 3:195560034-195560056 CTTTCCCCCAAACCGGGGAGTGG - Intergenic
968092375 3:195907436-195907458 CTCTGCCCCAGCCCGAGGTGTGG - Intronic
968204125 3:196783543-196783565 CTGTTCCCCAGGCTGGAGTGCGG - Intronic
968288352 3:197521142-197521164 CTTTCCCTCAGAATGGGGTGGGG - Intronic
968542476 4:1175082-1175104 CTTTTTCCCAGAGCGGCATGGGG + Intronic
969525828 4:7703603-7703625 CTGCTCCCCAGGCTGGGGTGGGG - Intronic
970008854 4:11436670-11436692 TTTTTCCACAGACCCGGGTGGGG + Intergenic
970038808 4:11772502-11772524 TTTTTCCACAGACTGGGATGGGG + Intergenic
970281865 4:14465494-14465516 CTTGTCATCAGACTGGGGTGTGG - Intergenic
970900484 4:21152901-21152923 TTTTTCCACAGACAGGGTTGGGG - Intronic
971324447 4:25632805-25632827 CTGTTGCCCAGACTGGAGTGCGG + Intergenic
973044387 4:45518357-45518379 CTGTTCCCCAGGCTGGAGTGCGG - Intergenic
974048585 4:56918454-56918476 CTGTTGCCCAGACTGGAGTGTGG - Intronic
975133517 4:70851378-70851400 TTTTTCCACAGACCAGGGTAGGG - Intergenic
975207574 4:71662663-71662685 CTGTTGCCCAGACTGGAGTGAGG + Intergenic
975441795 4:74419703-74419725 TTTTTCCACAGACCAGGGGGTGG + Intergenic
975960745 4:79901560-79901582 TTTTTCCACAGACCGGGGGGTGG + Intronic
976122692 4:81800310-81800332 TTTTTCCACGGACCAGGGTGTGG + Intronic
976734082 4:88293193-88293215 CTATTCCCCAGGCTGGAGTGCGG + Intergenic
976787217 4:88835454-88835476 CTTTTCCACAGACTAGGGGGTGG + Intronic
977100708 4:92810826-92810848 CTATTGCCCAGACTGGAGTGTGG + Intronic
977697810 4:99986136-99986158 CTGTTGCCCAGACTGGAGTGCGG - Intergenic
978535111 4:109754018-109754040 CTGTTGCCCAGACTGGAGTGCGG + Intronic
978754474 4:112287077-112287099 TTTTTCCACAGACTGGGGTTGGG + Intronic
980016668 4:127657913-127657935 TTTTTCCACAGACCAGGGTTGGG - Intronic
980023581 4:127738103-127738125 CTGTTCCCCAGGCTGGAGTGTGG + Intronic
980656562 4:135794437-135794459 TTTTTCCACAGACTGGAGTGGGG + Intergenic
981786307 4:148483109-148483131 TTTTTCCACAGACTGGGGTGGGG - Intergenic
981937977 4:150254715-150254737 CTGTTGCCCAGACTGGAGTGCGG + Intronic
982484443 4:155950856-155950878 TTTTTCCACGGACTGGGGTGTGG - Intronic
982896921 4:160942006-160942028 GTTTTCCACAGATGGGGGTGGGG + Intergenic
982923849 4:161310180-161310202 CTTTTGCCCAGGCTGGAGTGCGG + Intergenic
983629409 4:169834396-169834418 CTGTTGCCCAGACTGGAGTGCGG + Intergenic
983926533 4:173408953-173408975 CTTTCGCCCAGGCCGGAGTGCGG - Intergenic
984453229 4:179930507-179930529 CTGTTGCCCAGGCTGGGGTGTGG - Intergenic
985143860 4:186872633-186872655 TTTTTCCACAGACCAGGGTGGGG - Intergenic
985589623 5:757809-757831 CTGCTGCCCAGGCCGGGGTGTGG + Intronic
986064437 5:4221997-4222019 CTGTTGCCCAGGCTGGGGTGCGG - Intergenic
987984055 5:25123103-25123125 CTTTTACCCAGGCTGGAGTGTGG + Intergenic
988948165 5:36228653-36228675 CTGTTGCCCAGGCCGGGGTGTGG + Intronic
989408172 5:41085715-41085737 CTGTTGCCCAGGCTGGGGTGCGG + Intergenic
989552380 5:42751016-42751038 ATTTTCCACAGACTGGGATGGGG - Intergenic
989635817 5:43531618-43531640 CTGTTACCCAGGCTGGGGTGCGG - Intronic
989799095 5:45513741-45513763 TTTTTCCACAGTCAGGGGTGGGG - Intronic
990568780 5:57056793-57056815 TTTTTCCACAGACCGGGTAGTGG - Intergenic
990612111 5:57468116-57468138 TTTTTCCACAGACTGGGGGGTGG + Intergenic
991316144 5:65309092-65309114 CTTTTCCACAGACCAGGGTGGGG + Intronic
991358179 5:65791519-65791541 CTGTTGCCCAGGCTGGGGTGCGG - Intronic
991625241 5:68594298-68594320 TTTTTCCACAGATGGGGGTGGGG - Intergenic
992102566 5:73421208-73421230 CTGTTGCCCAGACTGGAGTGCGG - Intergenic
992434845 5:76746233-76746255 CTGTTGCCCAGGCCGGAGTGTGG + Intergenic
992629836 5:78669392-78669414 CTGTTGCCCAGGCTGGGGTGTGG - Intronic
993071282 5:83166916-83166938 CTGTCACCCAGACTGGGGTGCGG + Intronic
993809092 5:92453445-92453467 CTTTTGCCCAGACTGGAGTGGGG + Intergenic
994153417 5:96475187-96475209 TTTTTCCCCAGACTGGGATGAGG - Intergenic
994198821 5:96949494-96949516 TTTTTCCACAGACAGGGGTGTGG - Intronic
995225187 5:109692775-109692797 TTTTTCCACAGACAGGGGTGGGG + Intronic
995952458 5:117732533-117732555 TTTTTCCATAGACTGGGGTGGGG + Intergenic
997272663 5:132554937-132554959 TTTTTCCACAGACAGGAGTGGGG + Intronic
997543453 5:134684264-134684286 CTTTTGCCCAGGCTGGGGTGTGG - Intronic
997693876 5:135846217-135846239 TTTTTCCAAAGACCAGGGTGGGG - Intronic
998460927 5:142309471-142309493 CTGTTGCCCAGGCCGGAGTGCGG - Intergenic
999587275 5:153103845-153103867 CTTTTCCACAGACTGGGGGATGG - Intergenic
1000084605 5:157878525-157878547 CTTTTGCCCAGGCTGGAGTGCGG + Intergenic
1001225391 5:169940419-169940441 TTTTTCCACAGACCGGGAGGAGG + Intronic
1003279955 6:4682661-4682683 CATTTCCCCAGACCTTTGTGTGG - Intergenic
1003285708 6:4732296-4732318 CTGTTGCCCAGGCTGGGGTGCGG - Intronic
1003714586 6:8632210-8632232 CCTTTCCACAGACAGGGGTGGGG + Intergenic
1004444018 6:15681140-15681162 CTGTTGCCCAGACTGGAGTGCGG - Intergenic
1004645682 6:17558639-17558661 CTTTTCCACAGACAGGGTGGGGG - Intergenic
1004949761 6:20655695-20655717 TTTTTCCACAGACCGGGGGTGGG - Intronic
1004975554 6:20961728-20961750 CTTTTGCCCAGGCTGGAGTGCGG - Intronic
1006507497 6:34498935-34498957 TTTTTCCACAGACTGGGGTTGGG + Intronic
1006507505 6:34498963-34498985 GTTTTCCACAGACCAGGGTTAGG + Intronic
1006654542 6:35579088-35579110 ATTTTGCCCAGGCTGGGGTGCGG - Intronic
1008909360 6:56716801-56716823 TTTTTCCACAGACCAGGGTCAGG + Intronic
1009052196 6:58289654-58289676 TTTTTCCACAGACTGGGGTTGGG + Intergenic
1010152848 6:72755999-72756021 CTTTTCCACAGGCCTGCGTGAGG - Intronic
1011526718 6:88273263-88273285 CTGTTGCCCAGACTGGAGTGCGG - Intergenic
1011872929 6:91920064-91920086 CTGTTGCCCAGACTGGAGTGCGG + Intergenic
1013302866 6:108820513-108820535 CTTTTGCCCAGGCTGGAGTGTGG + Intergenic
1013335360 6:109153276-109153298 CTGTTGCCCAGACTGGAGTGCGG + Intronic
1013385490 6:109625680-109625702 TTTTTCCACAGACTGGGTTGTGG - Intronic
1014010437 6:116469414-116469436 TTTTTCCACAGACAGGGGTGGGG + Intergenic
1014227010 6:118860789-118860811 TTTTTCCACAGACCAGAGTGGGG + Intronic
1014527589 6:122519455-122519477 TTTTTCCACAGACGGAGGTGGGG - Intronic
1015016401 6:128418593-128418615 TTTTTCCCCAGATGAGGGTGAGG - Intronic
1015230719 6:130912166-130912188 TTTTTCCACATACCGGGGTGGGG - Intronic
1015582813 6:134745085-134745107 CTGTTCCCCAGATTGGAGTGTGG + Intergenic
1015832784 6:137387963-137387985 TTTTTCCACGGACCAGGGTGAGG - Intergenic
1016905631 6:149148046-149148068 CTCTTGCCCAGACTGGAGTGCGG + Intergenic
1017093781 6:150785934-150785956 CTTTTCCACAGACTGGATTGTGG - Intronic
1017735546 6:157359662-157359684 TTTTTCCATAGACCAGGGTGCGG + Intergenic
1018073657 6:160190559-160190581 CTGTTGCCCAGACTGGAGTGCGG + Intronic
1019287358 7:230354-230376 CTTGTCCCCAGGACGGGGTGGGG + Intronic
1019986278 7:4658553-4658575 TTTTTCCACAGACCAGAGTGGGG + Intergenic
1020567056 7:9810982-9811004 CTTTCCCCCAGGCTGGAGTGAGG - Intergenic
1021395105 7:20138114-20138136 CTGTTGCCCAGACTGGAGTGCGG - Exonic
1022020089 7:26391056-26391078 CTCTTGCCCAGACTGGAGTGTGG + Intergenic
1022723617 7:32962018-32962040 CTTTTTCCATGACCGGGGTGGGG - Intronic
1023049757 7:36240785-36240807 TTTTTCCGCAGACCTGGGTTGGG + Intronic
1023199699 7:37682991-37683013 TTTTTCCACAGACAGGGGTGGGG - Intergenic
1023728769 7:43170357-43170379 TTTTTCCACAGACAGGGGTGGGG - Intronic
1023835199 7:44063841-44063863 CCTTTCCCCAAACCAGGCTGTGG + Intronic
1024626628 7:51213446-51213468 TTTTTCCACAGACCAGGCTGGGG - Intronic
1024632214 7:51259248-51259270 CTGTTCCCCAGCCTGGAGTGCGG - Intronic
1024855166 7:53770430-53770452 CTGTTGCCCAGACTGGAGTGTGG + Intergenic
1025050011 7:55725899-55725921 CTTTTTCCGTGACCGGGGTGGGG + Intergenic
1025482618 7:61001681-61001703 CTTTCTCCCAGACTGGAGTGCGG - Intergenic
1025679097 7:63667545-63667567 CTGTTGCCCAGACGGGAGTGCGG + Intergenic
1025730597 7:64103473-64103495 CTGTTACCCAGACTGGAGTGTGG - Intronic
1025786718 7:64650633-64650655 CTGTTGCCCAGACTGGAGTGCGG - Intergenic
1026079880 7:67208282-67208304 CTGTTCCCCAGGCTGGGGTGCGG - Intronic
1026627444 7:72008690-72008712 CTTTTGCCCAGGCTGGGGTGAGG + Intronic
1026984471 7:74546256-74546278 CTGTTGCCCAGGCTGGGGTGTGG + Intronic
1027558700 7:79699398-79699420 CTTTTGCCCAGACTAGAGTGCGG + Intergenic
1028653741 7:93178716-93178738 TTTTTCCACAAACCGGGGAGTGG + Intergenic
1029241820 7:99168545-99168567 CTGTCCCCCAGGCTGGGGTGTGG + Intergenic
1029876298 7:103755774-103755796 CTGTCCCCCAGACTGGAGTGCGG - Intronic
1030199139 7:106884632-106884654 CTTTTCCACGGACAGGGGTGGGG + Intronic
1032116129 7:129118731-129118753 TTTTTCCACAGACCAGGGAGTGG - Intergenic
1032910866 7:136427988-136428010 CTGTTGCCCAGACTGGAGTGCGG - Intergenic
1033084388 7:138328967-138328989 CTGTTGCCCAGGCTGGGGTGCGG - Intergenic
1033857519 7:145582825-145582847 TTTTTTACCAGACCGGGGTGAGG - Intergenic
1034007696 7:147492108-147492130 TTTTTCTACAGACCAGGGTGGGG + Intronic
1034197072 7:149256177-149256199 GTTTTCCACAGACAGTGGTGGGG + Intergenic
1034237664 7:149585284-149585306 CTTTTCCCCAGTCCTTGGTCTGG - Intergenic
1034240745 7:149608943-149608965 CTTTTCCCCAGTCCTTGGTCTGG - Intergenic
1034477321 7:151293061-151293083 CTATCTCCCAGACTGGGGTGCGG - Intergenic
1035201817 7:157272583-157272605 CTTTTGCCCAGTCGGGGGTCAGG + Intergenic
1035251536 7:157600455-157600477 CTTTACCCCAGGCTGGAGTGTGG + Intronic
1035539448 8:421277-421299 TTTTTCCACAGACTGGGGCGAGG - Intronic
1037374581 8:18213848-18213870 CTCTCGCCCAGGCCGGGGTGCGG + Intronic
1037475002 8:19248527-19248549 CTTTTGCCCAGGCCGGAGTGCGG + Intergenic
1037752024 8:21688809-21688831 CTTTTGCCCAGGCTGGAGTGTGG - Intergenic
1037923297 8:22824484-22824506 TTTTTCCCCAGATGAGGGTGAGG + Intronic
1038799429 8:30735800-30735822 CTGTCCCCCAGGCTGGGGTGCGG - Intronic
1039921610 8:41897254-41897276 CTACTCCCGAGCCCGGGGTGCGG + Intergenic
1040808466 8:51422311-51422333 TTTTTCCACTGACCGGGGTGGGG - Intronic
1041250540 8:55930113-55930135 TTTTTCCACAGAGCGGGGTCAGG - Intronic
1041332967 8:56748385-56748407 CTTTTCCACAGACTGGGGGTAGG - Intergenic
1041451715 8:58013053-58013075 CTTCCCCCCAGACCTGGGAGGGG + Intronic
1042133079 8:65608490-65608512 CTTTTGCCCAGGCTGGAGTGAGG - Intronic
1042390912 8:68232653-68232675 CTGTTACCCAGACTGGAGTGCGG + Exonic
1042460085 8:69055041-69055063 CTGTTGCCCAGACTGGGGTGCGG - Intergenic
1043866828 8:85384162-85384184 TTTTTCCACAGACCGACGTGGGG - Intronic
1044064954 8:87687946-87687968 CTTTTCCACAGATGGGGGTTGGG + Intergenic
1044416417 8:91945187-91945209 TTTTTCCACAGACCAGGGTAGGG + Intergenic
1045031807 8:98144117-98144139 CTGTTGCCCAGACTGGAGTGTGG - Intronic
1047367480 8:124224733-124224755 CTGTTGCCCAGACTGGAGTGCGG - Intergenic
1047484852 8:125320137-125320159 CTGTTGCCCAGACCGGAGTGTGG - Intronic
1048071831 8:131029365-131029387 TTTTTCCACAGACATGGGTGGGG - Intronic
1048723793 8:137358717-137358739 TTTTTCCACAGACCAGGGTTAGG - Intergenic
1049049346 8:140181979-140182001 CTGGTCCCCAGACTGGGGAGAGG - Intronic
1049567907 8:143351541-143351563 CTGTCCCCCAGACTGGAGTGCGG - Intronic
1049844969 8:144795883-144795905 CTTTTCCCCACACACAGGTGGGG - Intergenic
1050228137 9:3485073-3485095 CTGTTTCCCAGACTGGAGTGCGG - Intronic
1050413980 9:5395928-5395950 CTGTTGCCCAGACTGGCGTGAGG + Intronic
1051689605 9:19696236-19696258 TTTTTCCACAGACCGAGGTTGGG - Intronic
1051849907 9:21494359-21494381 TTTTTCCATAGACCAGGGTGGGG + Intergenic
1052229159 9:26126290-26126312 CTGTTGCCCAGACTGGAGTGCGG - Intergenic
1053749355 9:41236667-41236689 CCTTTCAGCAGGCCGGGGTGGGG + Intergenic
1054254792 9:62801544-62801566 CCTTTCAGCAGGCCGGGGTGTGG + Intergenic
1054336512 9:63814058-63814080 CCTTTCAGCAGGCCGGGGTGGGG - Intergenic
1055846376 9:80568554-80568576 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1056941289 9:90958706-90958728 CCTTTCCCCAGGCTGGTGTGGGG - Intergenic
1057000111 9:91500888-91500910 CTAAACCCCAGACGGGGGTGGGG + Intergenic
1057076884 9:92142523-92142545 CCTTTCCCCAGAGCGGGGCTGGG - Intergenic
1057171595 9:92966274-92966296 CTTGTCCCCAGACCCAGATGTGG - Intronic
1057559710 9:96117597-96117619 ATTGTCCCCAGTGCGGGGTGAGG + Intergenic
1058888112 9:109338377-109338399 CTGTTGCCCAGACTGGAGTGCGG + Intergenic
1058890327 9:109355652-109355674 CTGTCCCCCAGGCTGGGGTGTGG + Intergenic
1058999282 9:110331635-110331657 TTTTTCCCCAGACTGGGGGTGGG + Intronic
1060245045 9:121938250-121938272 CTGTTCCCCAGGCTGGAGTGTGG - Intronic
1060345959 9:122815999-122816021 TTTTTCCACAGACTGGGGTTGGG + Intronic
1060520946 9:124293751-124293773 CTTTTCACCGGGCCTGGGTGAGG + Intronic
1061581178 9:131537432-131537454 CTTTTCCACAGACTGGGTAGGGG + Intergenic
1061926705 9:133809444-133809466 TTCTTCACCAGACTGGGGTGAGG + Intronic
1062653973 9:137592549-137592571 CTGTTGCCCAGACTGGAGTGTGG - Intergenic
1062687301 9:137820728-137820750 CTTTTCCCCAGTCAGCAGTGTGG + Intronic
1203443209 Un_GL000219v1:30721-30743 CTGTTGCCCAGGCTGGGGTGCGG + Intergenic
1203514017 Un_KI270741v1:149630-149652 CTGTTGCCCAGGCTGGGGTGCGG + Intergenic
1185811120 X:3111617-3111639 TTTTTCTGCAGACTGGGGTGGGG + Intronic
1186211294 X:7253112-7253134 CTGTTGCCCAGGCTGGGGTGAGG - Intronic
1186480385 X:9892214-9892236 CTGTTGCCCAGACTGGAGTGCGG - Intronic
1187145486 X:16633118-16633140 CTATTGCCCAGACTGGAGTGCGG + Intronic
1187386240 X:18851339-18851361 GTTTTCCACAGACTGGGGTGGGG - Intergenic
1187386250 X:18851367-18851389 TTTTTCCACAGACTGGGGTCGGG - Intergenic
1188118524 X:26276405-26276427 CTGTTGCCCAGACTGGAGTGCGG + Intergenic
1189637964 X:43032349-43032371 CTGTTGCCCAGACTGGAGTGCGG - Intergenic
1190810126 X:53874889-53874911 CTGTTGCCCAGGCTGGGGTGCGG - Intergenic
1191764411 X:64681826-64681848 TTTTTCCACAGACCAGGGAGAGG + Intergenic
1191977571 X:66890672-66890694 CTGTTGCCCAGACTGGAGTGCGG + Intergenic
1192422049 X:71042148-71042170 CTGTTGCCCAGACTGGAGTGCGG - Intergenic
1192590801 X:72357939-72357961 CTTTTGCCCAGGCTGGAGTGCGG + Intronic
1195650061 X:107274693-107274715 CTTTTCTCAAGACAGGTGTGAGG + Intergenic
1195926339 X:110029446-110029468 CTTTTCCCCTGACAGAAGTGAGG + Intronic
1196054085 X:111336269-111336291 CTTTTCCCAAAGCCTGGGTGTGG - Intronic
1198415603 X:136416764-136416786 CTTTTCCCCAATCAGGGGTTGGG - Exonic
1199672036 X:150155566-150155588 GTTTTCCCCAGTCCTGGGTGGGG - Intergenic
1200133861 X:153865243-153865265 CTCCTCCCCAGACCTGGGCGAGG - Intronic
1200254183 X:154570665-154570687 GTTTTCCACAGACGGGGATGGGG + Intergenic
1200263586 X:154633743-154633765 GTTTTCCACAGACGGGGATGGGG - Intergenic
1201241863 Y:11965120-11965142 TTTTTCCACAGACAGGGTTGGGG + Intergenic